Acetylsalicylic acid combined with diclofenac inhibits gristle debasement in coney theoretical accounts of degenerative arthritis
Runing rubric:Acetylsalicylic acid plus diclofenac in OA
Highlights:
1. Acetylsalicylic acid combined with diclofenac reduces the content of NO and IL-1? .
2. Acetylsalicylic acerb plus diclofenac inhibited MMP-3 and MMP-13 protein look.
3. PCR found that mRNA look ofTIMP1was up-regulated.
Abstraction
Aim:This survey was aimed to research the consequence of different concentration of acetylsalicylic acid combined with diclofenac on articular gristle of coney theoretical accounts of degenerative arthritis ( OA ) .
Methods:Entire 40 New Zealand white coneies were divided into 5 groups ( A, B, C, D and E ) . Group A was sham-operation normal control group which was treated with normal saline. Group B, C, D and E were OA theoretical account groups and were severally treated with normal saline and acetylsalicylic acid combined with diclofenac of 5 mg/kg, 10 mg/kg and 20 mg/kg. Cartilage macroscopic scrutiny and pathological observation were performed to analyse the construction of articular gristle in all the groups of intervention. The content of azotic oxide ( NO ) and interleukin 1? ( IL-1? ) were detected by enzyme-linked immuno sorbent check ( ELISA ) . The protein look of matrix metalloproteinase 3 ( MMP-3 ) and MMP-13 were detected by western smudge. The mRNA look of the tissue inhibitor of metalloproteinases 1 (TIMP1) was detected by polymerase concatenation reaction ( PCR ) .
Consequences:The different concentrations of the drugs reduced the tonss of cartilago articularis, the content of NO and IL-1? , and protein look of MMP-3 and MMP-13. PCR found that mRNA look ofTIMP1was up-regulated.
Decision:The disposal of different concentrations of acetylsalicylic acid combined with diclofenac dramas preventive or curative effects on progressive OA.
Cardinal words:acetyl salicylic acid combined with diclofenac ; degenerative arthritis ; interleukin 1? ; azotic oxide ; matrix metalloproteinase
1. Introduction
Osteoarthritis ( OA ) is one of the most common degenerative joint disease in older grownups, characterized by gristle scratchs and debasement, subchondral bone remodeling, osteophyte formation, and low-grade redness [ 1, 2 ] . OA is considered to be induced by several complex interactions and cross-talk affecting proteoglycan debasement, progressive eroding of articular gristle, and break of the collagen web, which lead to trouble, stiffness, and chronic physical and functional disablement [ 3-5 ] . For case, cytokines interleukin 1? ( IL-1? ) , inducible azotic oxide synthase ( iNOS ) , and attendant matrix metalloproteinases ( MMPs ) are of import katabolic factors for the eroding and proteolysis of extracellular matrix constituents of the gristle [ 6, 7 ] . Consequently, how to down-regulate the katabolic factors become an of import mark for research on optimum interventions of OA.
Presently, pharmacological curative agents for OA represent the pillar of intervention, which chiefly include anodynes and non-steroidal anti-inflammatory drugs, such as acetylsalicylic acid and diclofenac [ 8 ] . Acetylsalicylic acerb exerts anti-inflammatory, analgetic and antipyretic actions and is the most widely used drug in clinical hurting of degenerative arthritis [ 9 ] . Diclofenac, a non-steroidal anti-inflammatory drug, can by and large diminish hurting and stiffness and better map and has been extensively used in the direction of degenerative arthritis [ 10 ] . Importantly, the two sorts of drugs have been linked to increased bone mineral denseness, which potentially decreased the break hazard [ 11-13 ] .
In position of the effects of acetylsalicylic acid or diclofenac entirely on OA, we investigated the protective effects of assorted doses of acetylsalicylic acid combined with diclofenac on the standard coney anterior cruciate ligament transection ( ACLT ) theoretical account of OA. Furthermore, we comprehensively evaluated the production of katabolic factors including IL-1? , azotic oxide ( NO ) , MMP-3 and MMP-13 to look into the mechanism of the two sorts of drugs in combination on OA. We speculated that the disposal of larger dosage of acetylsalicylic acid in combination with diclofenac would hold better functions in the patterned advance of gristle debasement and pathogenesis of OA.
2. Materials and methods
2.1 Experimental animate being theoretical account
Forty healthy grownup New Zealand white coneies ( 20 female and 20 male ) of average weight 2.5 ± 0.5 kilogram were purchased from the carnal centre of Shandong University and used in this survey. This survey to the full complied with the national statute law and theGuide for the Care and Use of Laboratory Animalsissued by the Ministry of Health of the People’s Republic of China and was approved by the local research ethical commissions.
All coneies were anesthetized by an ear fringy vena injection of Nembutal ( 30 g/L ) . Thirty two coneies were indiscriminately selected to bring on OA theoretical account. For each of the 32 coneies, a median parapatellar scratch was made through the tegument of left hind limb articulatio genus. Then, ACLT [ 14-16 ] and complete meniscectomy were performed to bring on left hind limb articulatio genus OA. The other 8 coneies were sham-operation group. They were besides made a median parapatellar scratch but non performed ACLT and meniscectomy. Each animate being received antibiotic prophylaxis with intramuscular injection of Garamycin ( 0.48 g per twenty-four hours ) for 5 yearss following surgery.
The 8 coneies treated with sham-operation was regarded as group A and the other 32 experimental animate beings were indiscriminately assigned to 4 groups ( B, C, D and E ) . Group A and B were severally normal control and theoretical account control, which were treated with normal saline ; group C was treated with low-dose acetylsalicylic acid ( pureness & A ; gt ; 98 % , Sangon Bictech Corporation, Shanghai, China ) combined with diclofenac ( pureness & A ; gt ; 98 % , Sangon Bictech Corporation, Shanghai, China ) ( 5 mg/kg ; acetylsalicylic acid: diclofenac = 1:1 ) ; group D was treated with median-dose acetylsalicylic acid combined with diclofenac ( 10 mg/kg ; acetylsalicylic acid: diclofenac = 1:1 ) ; group D was treated with large-dose acetylsalicylic acid combined with diclofenac ( 20 mg/kg ; acetylsalicylic acid: diclofenac = 1:1 ) . These different concentration of drugs were given through intraperitoneal injection for 4 hebdomads.
2.2Macroscopic scrutiny of thecartilago articularis
The articulatio genus articular gristle tissues were macroscopically scored with hiting systems as described antecedently by Pelletieret Al. [ 17 ] , as follows: 0 = articular gristle surface is smooth and appears light blue or colourless translucent ; 1 = articular gristle surface is malacic but smooth ; 2 = articular gristle tends to thin and appears little fibers bundle ; 3 = articular gristle appears obvious fiber package ; 4 = articular gristle appears wear and tear of fibre bundle accompany with the subchondral bone exposure and osteosclerosis.
2.3Cartilage pathological observation
After forfeit, the left hind limb articulatio genus articulations of the 40 coneies were resected and instantly fixed in 4 % paraformaldehyde for 24 h. The tissues were so decalcified in 10 % ethylenediaminetetraacetic acid ( EDTA ) decalcifying solution ( pH 7.2-7.5 ; incorporating 0.01 % Na azide ) for 12 hebdomads and the decalcifying solution was changed every 3 yearss. After decalcification, the tissues were embedded in paraffin and cut into 4-?m-thick subdivisions for histological rating. The subdivisions were stained with hematoxylin and eosin ( HE ) . All the subdivisions were observed utilizing 1?70 upside-down stage contrast microscope ( TS100, Nikon Corporation, America ) .
2.4 Determination content of NO and IL-1?
The coney knee joint pit was injected with 1.0 milliliters normal saline. Then the joint fluid was drained repeatedly and injected into the trial tubing. The sensing method was harmonizing to the direction of NO and rabbit IL-1? enzyme-linked immuno sorbent check ( ELISA ) kit.
2.5 MMP-3 and MMP-13protein lookanalysis
Western smudge was used to find the protein look. Briefly, approximately 20 mg femoral gristle devolution portion tissue samples of coneies were cut into pieces and placed in the homogenizer. Then 1 milliliters TRIzol reagent ( Becton Dickinson, America ) and 40?l 10mmol/L phenylmethanesulfonyl fluoride were added to the civilization flask and kept in an ice bath for 10 min. The tissue lysates were added to eppendorf tubing and kept in an ice bath for 30 min. The supernatants were collected by centrifugation at 12000 g for 15 min. The entire protein concentrations of gathered supernatants were measured by bicinchorinic acid assay ( BCA ) . The samples were separated on 12 % Na dodecyl sulphate-polyacrylamide gel cataphoresis ( SDS-PAGE ) . Then the proteins band were transferred to polyvinylidene fluoride membranes and were blocked for 1 H at room temperature. Membranes were farther incubated with rabbit anti-human MMP-3 and MMP-13 antibodies and rat anti-human glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) antibodies ( 1:500 ; Becton Dickinson, America ) at 4a„? overnight. After rinsing, the membranes were later incubated with secondary antibodies ( 1:1000 ; Zemai Biotech Corporation, Shanghai, China ) for 1 H at room temperature. The reaction was visualized utilizing the enhanced chemiluminescence sensing system.
2.6Tissue inhibitor of metalloproteinases 1 messenger RNAs lookanalysis
Entire RNA was extracted from femoral gristle devolution portion tissue of coneies utilizing TRIzol reagent ( Becton Dickinson, America ) harmonizing to the manufacturer’s instructions. After mensurating the entire RNA, RNA was subjected to change by reversal written text ( RT ) into complementary DNA harmonizing to the maker ‘s instructions of PrimeScript RT reagent kit ( Code No.9160 ; Sigma, America ) : 2 µl 5 ? PrimeScript Buffer, 0.5 µl PrimeScript RT Enzyme Mix, 2 µl Total RNA and 5 µl RNase Free dH2O ( concluding volume 10 µl ) reacted at 37 a„? H2O bath for 15 min, so reacted at 85a„? for 15 s. The tissue inhibitor of metalloproteinases 1 (TIMP1) primer ( 5′-3 ‘ ) was GTCGCATGCTGCGAGTTGAC, GGGTGGCCAAGAGCCTTGT. Real-time fluorescent quantitation polymerase concatenation reaction ( PCR ) was performed harmonizing to SYBR Premix Ex Taq TM II ( Perfect Real Time ) ( Code No. RR041A ; Sigma, America ) utilizing the ZY325161 Real-Time PCR machine ( Eppendorf, Germany ) . Briefly, 2 µl of complementary DNA was assorted with 12.5 µl SYBR Premix Ex Taq, 1 µl PCR Forward Primer, 1 µl PCR Reverse Primer, 8.5 µl dH2O ( concluding volume 25 µl ) . The PCR cycling conditions were 40 repetitions of 95a„? for 5 min, 95a„? for 20 s, 60a„? for 30 s and 72 a„? for 20 s, and 71 repetitions of 60-95a„? for 20 s with temperature rise by 0.5a„? for each repetition. The messenger RNA degrees of samples were normalized to theGAPDHmessenger RNA degrees as an internal control and the primer ( 5′-3 ‘ ) was ACGTCCCATCACGATCCTTC, ACACTCGGATGACGAACT. Finally, 10µl PCR merchandises were performed 1 % agarose gel cataphoresis.
2.7 Statistical analysis
Datas are expressed as the agencies ± standard divergence ( SD ) , and statistical analysis was carried out with SPSS version 13.0 package for Windows. The pairwise comparing of multiple samples used Bonferroni Test of One-way ANOVA. A value of P & A ; lt ; 0.05 was considered to bespeak statistical significance.
3. Consequence
3.1 Macroscopic scrutiny of the cartilago articularis
The cartilago articularis of group A was scored 0, of which cartilago articularis surfaces were orderly surface without clefts, defects, softening and osteophyte. Group B was scored 3.9, of which cartilago articularis surfaces appeared obvious fiber package, clefts, defects and softening, besides, portion of the subchondral castanetss exposed with osteophyte along the border. After coneies were treated with drugs, cartilago articularis surfaces became more smooth with little fibers package, capilar clefts, besides, the grade of gristle wear and osteophyte formation was significantly declined compared with the theoretical account control of group B. Group C was scored 3.1, group D was scored 2.5, and group E was scored 1.8 ( Figure 1 ) .
3.2 Cartilage pathological observation
For the normal control of group A, the articular gristle surfaces were orderly, semitransparent, glistening and flexible without clefts, defects, softening and osteophytes. For the theoretical account control of group B, the articular gristle surfaces were unsmooth without normal lustre and snap, besides, the surfaces appeared obvious fiber package, clefts, defects, softening, and portion of the subchondral castanetss exposed with osteophyte along the border. For the large-dose intervention of group E, the articular gristle surfaces appeared yellowandwhite and partially loss of normal lustre, besides, the surfaces became more smooth with little fibers package, capilar clefts and the grade of gristle wear and osteophyte formation was significantly declined compared with group B, low-dose and median-dose intervention groups ( Figure 2 ) .
3.3 Effectss of drugs on the content of NO and IL-1? in joint fluid
The contents of NO ( 5.97 ± 0.9 ) and IL-1? ( 7.03 ± 0.8 ) in group A were significantly ( P & A ; lt ; 0.05 ) less than in group B ( NO: 13.21 ± 1.2, IL-1? : 15.43 ± 1.4 ) . After coneies were treated with different doses of drugs, contents of NO and IL-1? in all the 3 groups declined significantly ( P & A ; lt ; 0.05 ) , particularly for large-dose intervention of group E ( NO: 7.32 ± 0.6, IL-1? : 8.43 ± 0.4 ) ( Figure 3 ) .
3.4 Effectss of drugs on MMP-3 and MMP-13 protein look
Figure 4 showed that the protein look degrees of MMP-3 and MMP-13 were high in group B. After coneies were treated with drugs, the look degrees of MMP-3 and MMP-13 in all the 3 groups declined, particularly for large-dose intervention of group E.
3.5 Effectss of drugs onTIMP-1 messenger RNA look
The mRNA look degrees of TIMP-1 were shown in Figure 5. The look degrees of TIMP-1 in group C, D and E ( C: 0.42 ± 0.01, D: 0.55 ± 0.02, Tocopherol: 0.73 ± 0.01 ) declined significantly ( P & A ; lt ; 0.05 ) compared with in group B ( 0.31 ± 0.00 ) . Besides, the effects enhanced with the addition of the concentration.
4. Discussion
OA is soon considered as a planetary organ failure affecting all the tissues of the joint [ 18 ] . The intervention of OA has by and large been aimed at relieving hurting, swelling and musculus stringency to better the mobility [ 3 ] . Numerous OA patients have experienced alleviation of joint hurting and betterment in mobility as a consequence of taking acetylsalicylic acid or diclofenac. In this survey, we examined the effects of different concentrations of acetylsalicylic acid combined with diclofenac on the OA coney theoretical account. We found that drugs in 3 groups of concentrations reduced the cartilago articularis tonss and reduced the content of NO and IL-1? . In add-on, the look of MMP-3 and MMP-13 protein was down-regulated and mRNA look ofTIMP1was up-regulation of mRNA look.
For the present survey, gristle macroscopic scrutiny and pathological observation were performed to analyse the construction of articular gristle in all the groups of intervention. The hiting system [ 17 ] is widely used for measuring histologic findings of osteoarthritic specimens and the osteophyte formation and gristle lesions have long been used as observation indexes [ 19, 20 ] . The hiting consequence showed a important suppression of degenerative alterations in the gristle by drugs intervention ( Figure 1 ) , which was consistent with the histologic appraisal ( Figure 2 ) . These consequences may bespeak that disposal of acetylsalicylic acid combined with diclofenac has a consequence on the development of gristle degenerative alterations.
Proinflammatory cytokine of IL-1? exerts a katabolic consequence on the chondrocyte metamorphosis, which decreases proteoglycan collagen synthesis and increases aggrecan release via barricading peptidases [ 21 ] . In add-on, IL-1? may trip synovial cells to increase the cistron look of MMPs which are katabolic factors for the eroding and proteolysis of extracellular matrix constituents of the gristle [ 6 ] . IL-1? besides induces synovial cells and chondrocytes to bring forth other inflammatory go-betweens such as IL-6, IL-8 and NO [ 22 ] . NO is a extremely reactive free group every bit good as a major katabolic factor synthesized from the L-arginine by the members of iNOS [ 23, 24 ] . Overproduction of NO consequences in tissue harm and inflammatory response, which plays an of import function in the pathogenesis of redness [ 25 ] . Zhouet Al. [ 24 ] suggested that NO led to articular chondrocytes apoptosis by the suppression of protein kinase C which participated in modulating articular chondrocytes programmed cell death. In the present survey, acetylsalicylic acid plus diclofenac significantly inhibited the IL-1? and NO production, proposing that the suppression of the inflammatory go-betweens may be responsible for the anti-inflammatory effects of acetylsalicylic acerb plus diclofenac.
For the other katabolic factor of IL-1? , MMPs comprise a household of Zn2+dependent extracellular enzymes incorporating combined ability of degrading extracellular matrix constituents every bit good as remodelling normal and pathological tissue [ 26, 27 ] . MMPs are demonstrated to be involved in bone reabsorption and matrix debasement [ 28, 29 ] . As an array of peptidases, MMPs can interrupt down proteoglycans and type II collagen which are the chief constituents of the articular gristle, taking to proteolysis of gristle [ 26 ] . Specially, MMP-3 has ability to degrade assorted constituents of gristle, and MMP-13 is capable of degrading integral type II collagen [ 27, 30 ] . The increased sums of proMMPs and MMP production have been found in synovial fluid and joint pathology [ 31-33 ] . Importantly, research found that gristle debasement occurs non merely as a consequence of the addition of MMPs but besides because of an instability between extracellular matrix proteases and their inhibitors, in peculiar MMPs and TIMPs [ 34 ] . MMPs are inhibited by specific endogenous TIMPs which are glycoproteins and suppress all MMPs on a 1:1 footing by organizing high-affinity composites [ 35 ] . Specially, TIMP-1 inhibits MMP-1, MMP-3, MMP-9 and MMP-13 [ 36 ] . The consequence of western smudge analysis found that the protein looks of MMP-3 and MMP-13 were down-regulated after administering drugs, particularly for large-dose intervention. Furthermore, consequence of PCR found that mRNA look ofTIMP1was up-regulated after coneies were treated with drugs, besides, the effects enhanced with the addition of the concentration. These consequences indicated the functions of acetylsalicylic acid combined with diclofenac in relieving the devastation of articular gristle matrix and detaining the procedure of degenerative arthritis.
In decision, our findings indicate that the disposal of acetylsalicylic acid combined with diclofenac dramas preventive or curative effects on progressive OA. This consequences may be achieved by suppression of the look of MMP-3 and MMP-13 and addition of the look of TIMPs to suppress the degration of extracellular matrix constituents and type II collagen of the gristle. Clinical tests are needed to corroborate our survey in human patients with OA.