Chapter 1
Introduction
1.1 Chalcone synthase
Chalcone synthase [ CHS ; malonyl-CoA: 4-coumaroyl-CoA malonyltransferase ( cyclizing ) , EC 2.3.1.74 ] is a cardinal enzyme in the biogenesis of flavonoid antimicrobic phytoalexins and anthocyanin pigments in workss. CHS supplies 4,2′,4′,6′-tetrahydroxychalcone to downstream enzymes that synthesize a diverse set of flavonoid phytoalexins and anthocyanin pigments ( Jean-Luc, 1999 ) . It catalyzes the bit-by-bit reaction of three ethanoate residues from malonyl-CoA with 4-coumaroyl-CoA to give the intermediate naringenin-chalcone ( Hans et al. , 1986 ) .
CHS cistrons, or complementary DNA transcripts of these cistrons, have been cloned, sequenced and characterized from several works species including Antirrhinum majus, Zea mays, Petunia hybrida, Petroselinum hortense, and Phaseolus vulgaris, Sorghum bicolor, Bromheadia finlaysoniana, Arabidopsis, Mattthiola, snowdragon, maize, Petroselinum crispum, bean, leguminous species and pines ( Arjula et al. , 1996 ; Yongzhen et al. , 2005 ) . The chs cistrons are structurally conserved and most of them contain one noncoding DNA and two coding DNAs and the cloned chs cistrons are belong to little multi-gene household ( Yongzhen et al. , 2005 ) .
The chalcone synthase cistrons present a high grade of sequence similarity at the amino acerb degree and have been the object of legion surveies in dicotyledonous workss, where up to seven transcripts have been identified in several species ( Mary et al. , 2000 ) . In the monocotyledonous, most of the genera studied ( i.e. Zea, Oryza, Hordeum and Secale ) have two transcripts of the chalcone synthase cistron ( Miriam et al. , 2001 ) , although seven transcripts have been identified in Sorghum bicolor by Lo and Nicholson ( 1999 ) ( Miriam et al. , 2001 ) .
A rice complementary DNA ringer, Os-chs complementary DNA, encoding chalcone synthase, isolated from a foliage complementary DNA library of an indica rice assortment Purpleputtu has been mapped to the centromeric part of chromosome 11 of rice. Familial analysis of violet pigmentation in two rice lines, Abhaya and Shyamala, used in the present function surveies, indicated the engagement of three cistrons, one of which has been identified as a dominant inhibitor of leaf pigmentation. The Os-chs complementary DNA shows extensive sequence homology, both for Deoxyribonucleic acid and protein ( deduced ) , to that of corn, barley and besides to different liliopsids and magnoliopsids ( Arjula et al. , 1996 ) .
CHS has been shown to be under a complex system of ordinance, and a figure of possible regulative elements have been identified. CHS activity was foremost described in 1972 in infusions of Petroselinum crispum ( Petroselinum crispum ) in the group of research workers in Freiburg ( Kreuzaler et al. , 1972 ) . The enzyme was foremost labelled as flavanone synthase, because the chalcone was so rapidly converted to the flavanone in a non-enzymatic reaction that was non noticeable as the initial merchandise. It was corrected a few old ages subsequently with improved techniques, even though the incorrect name was used in the publications up to that clip.
In many workss, look of the chs cistron is tigthly regulated in a tissue-specific mode and the enzyme can be induced by the phytochrome system, UV-light or elicitors. These belongingss make the cistron an attractive system for analyzing the assorted manners of ordinance of cistron look in workss ( Hans et al. , 1986 ) . For illustration, in darkgrown Petroselinum crispum ( Petroselinum crispum ) cell suspension civilizations, irradiation with UV visible radiation or UV incorporating white light leads to a monolithic addition in CHS transcriptional activity 2-4 H after the oncoming of intervention ( Paul et al. , 1989 ) .
1.2 Aims
Limited surveies have been carried on cistron look in bananas and small work has been published on the flavanoid tracts or their related cistrons in this works. Cultivated Bananas are usually unfertile and seedless while their wild opposite numbers are fertile. A old survey ( Foo, 2009 ) had analyzed CHS cistron sequences from different bananas and shown differences in their sequence. This research focused on analyzing the differential cistron look degrees of chalcone synthase ( CHS ) between wild type ( AA ) and cultivated ( AA ) bananas. The aims of this survey were:
1. To pull out and analyze the entire RNA from both wild type seeded banana ( Musa acuminata ssp malaacencis AA ) and unseeded cultivated banana, Mas ( AA ) by utilizing a CTAB ( modified ) method.
2. To analyze the differential look degrees of the chalcone synthase cistrons in the seeded and unseeded banana by utilizing real-time PCR.
3. To analyze the correlativity if any between differences in chalcone synthase cistron look and parthenocarpy in banana.
Chapter 2
LITERATURE REVIEW
2.1 Flavonoids
Flavonoids are biologically major and chemically diverse group of secondary metabolites that can be divided into subgroups including anthocyanidins, flavonols, flavones, flavanols, flavanones, chalcones, dihydrochalcones and dihydroflavonols, Isoflavonoids and pterocarpanes may besides be included. Flavonoids are really of import for the pigmentation of flowers and, therefore, act as attractants to pollinator and have many maps in workss. Flavonoids besides play an of import function in protection against UV visible radiation, works pathogen defence initiation of nodulation, auxin conveyance, pollen map, and insect opposition. The diverseness in flower colour is about surely due to differences in either the structural or the regulative cistrons of the flavonoid biosynthetic tract ( Tsukasa, 2000 ) .
In general, workss possess the biosynthetic ability of the flavonoids and non animate beings and Fungis, except marine coral. Flavonoids can be divided into several categories, such as anthocyanins, flavones, flavonols, flavanones, dihydroflavonols, chalcones, aurones, flavonons, flavan and proanthocyanidins, isoflavonoids, biflavonoids, etc. Furthermore, legion flavonoid compounds occur in workss by extra hydroxyl, methoxyl, methyl and/or glycosyl permutation forms. Occasionally, aromatic and aliphatic acids, sulphate, prenyl, methylenedioxyl or isoprenyl groups besides attach to the flavonoid karyon and their glycosides.
2.3. Flavonoid biogenesis tract. Buddy: Phenylalanine ammonia-lyase ; C4H: cinnamate-4-hydroxylase ; 4CL: 4-coumaroyl: CoA-ligase ; CHS: chalcone synthase ; CHI: chalcone isomerase ; FSI: flavone synthase ; FSII: cytochrome P450 flavone synthase ; IFS: cytochrome P450 isoflavone synthase ; FHT: flavanone 3?-hydroxylase ; DFR: dihydroflavonol 4-reductase ; LAR: leucoanthocyanidin synthase ; ANS: anthocyanidin synthase ; 3GT: UDPG-flavonoid 3-O-glucosyl transferase. Red text indicates cytochrome P450 enzymes.
( adapted from Chemler et al. , Microbial Cell Factories 2006, 5:20 ) .
Furthermore, more than 4,000 sorts of flavonoids have been reported as of course happening compounds. In most instances, the flavonoids are present as glycosides in vacuoles of flowers, foliages, stems or roots. Flavonoid aglycones, and polymethylated flavonoids, were reported as farinose exudations or wax on the foliages, barks and buds, or crystals in the cells of cacti ( Tsukasa, 2000 ) . Among the big figure of phenolic phytoalexins, isoflavonoids, phenylpropanoids and simple phenoplasts are good elucidated, whereas the function of flavonoids in defense mechanism is less popular, except the catechins and proanthocyanidins ( Dieter, 2006 ) .
Furthermore, they possess a broad scope of biological activities and one of them is their part to human wellness which has made them outstanding in the past 10 old ages. Many flavonoids are active rules of medicative workss and exhibit pharmacological effects ( Dieter, 2006 ) . In general, they are besides good for the works itself as physiological active compounds, as emphasis protecting agents, as attractants or as feeding hindrances, and by their important function in works opposition.
Harmonizing to the literature reviews, flavonoids belong to a group of natural substances and are found in fruit, veggies, grains, bark, roots, stems, flowers, tea, and vino. Before flavonoids were isolated as the effectual compounds, these natural merchandises were known for their good effects on wellness. More than 4000 assortments of flavonoids have been identified and an of import consequence of flavonoids is the scavenging of oxygen- derived free groups. In vitro experimental systems besides showed that flavonoids possess antiinflammatory, antiallergic, antiviral, and anticarcinogenic belongingss ( Robert, 2001 ) .
2.2 Chalcone Synthase in Plants
CHS is the entry point into flavonoid biogenesis, and the cistrons are under complex ordinance. An of import development was the first study on a crystal construction, from the CHS of Medicago sativa, in the group of J. Noel ( Jean-Lac, 1999 ) . 2-Pyrone synthase ( 2-PS ) and chalcone synthase ( CHS ) are plant-specific PKSs that exhibit 74 % amino acid individuality. 2-PS and CHS portion a common 3-dimensional crease, a set of conserved catalytic residues, and similar CoA binding sites.
The construction of CHS complexed with resveratrol can be considered how stilbene synthase, a related enzyme, uses the same substrates and an alternate cyclization tract to organize resveratrol. By utilizing the 3-dimensional construction and the big database of CHS-like sequences, can place proteins likely to possess fresh substrate and merchandise specificity ( Jean-Lac, 1999 ) . In grapes and ruddy vino, a works phenoplast compound, resveratrol is found but is non widely distributed in other common nutrient beginnings. There is no resveratrol synthase in tomato, the precursor molecules are all present and used by chalcone synthase ( CHS ) , the cardinal enzyme of flavonoid biogenesis ( Ingrosso et al. , 2009 ) .
The construction provides a model for technology CHS-like enzymes to bring forth new merchandises and elucidates the chemical footing of works polyketide biogenesis. Chalcone synthase ( CHS ) operates early in the biosynthetic tract of flavonoids, secondary metabolites which play of import functions in the interactions which occur between workss and their environment ( Miriam et al. , 2001 ) .
Several studies showed that Chalcone synthase plays indispensable function in the biogenesis of works phenylpropanoids. The works phenylpropanoid tract provides anthocyanins used for pigmentation and protection against UV photodamage, antimicrobic phytoalexins and flavonoid inducers of Rhizobium nodulation cistrons. The phenylpropanoids exhibit malignant neoplastic disease chemopreventive, antimitotic, estrogenic, antimalarial, antioxidant and antiasthmatic activities as medicative natural merchandises ( Rhonda et al. , 1988 ) .
The accretion of flavone, flavonol, and isoflavonoid compounds in response to UV visible radiation and pathogen emphasis has been shown to be due to an addition in the rate of written text of the Chalcone synthase ( CHS ) cistron, which encodes the first enzyme unique to flavonoid biogenesis, and other flavonoid biosynthetic cistrons ( Rhonda et al. , 1988 ) . The accretion of anthocyanins in response to specific environmental conditions might besides be due to transcriptional ordinance of CHS and other cistrons in the biosynthetic tract.
Peters et al. , ( 1986 ) have shown that this chalcone synthase is involved in pigment formation, mutualism, and works defences against pathogen onslaught and exposure to ultra-violet visible radiation. This enzyme is well-conserved among workss of different groups, and that it has a cysteine residue at amino acid 169 that is thought to be portion of the 4-coumaroyl-CoA binding site and which is required for enzyme activity ( Miriam et al. , 2001 ) . Mary et Al. ( 2000 ) have pointed out that chalcone synthase is suited for
surveies of cistron duplicate and probes on the beginning of cistron households. The chalcone synthase group 1 is the well-conserved chalcone synthase found in workss and is extremely homologous to sorghum chalcone synthases ( Miriam et al. , 2001 ) .
Most of the research workers focused on the booster part of the chalcone synthase ( CHS ) cistron because it is among the best-characterized boosters in workss and its look is induced by multiple cues. Among those cues, visible radiation and insect herbivores were shown to upregulate CHS look in A. thaliana ( Juliette et al. , 2006 ) . In add-on, CHS is the branch-point enzyme of a tract involved in the interaction between workss and their abiotic and biotic environments, hence this cistron is likely to play a function in adaptative development. However, forms of nucleotide fluctuation in the A. thaliana CHS booster showed no grounds of non-neutral development in this inbreeding one-year species ( Juliette et al. , 2006 ) .
In petunia, CHS comprises a multigene household in which merely one cistron is expressed to high degrees in petal tissue ( Ronald et al. , 1989 ) . In corn, CHS has been shown to be rate restricting for anthocyanin production, although it is non restricting in Antirrhinum. The flower forms were elicited by the CHS transgene frequently vary among the flowers of a individual works. The phenotypes with an antisense CHS cistron were non same as the sense phenotypes either in the grade of pigment decrease or in the nature of the forms. The sense transgene affected all pigmented flowered parts ( corolla limbs, corolla tubings, and anthers ) , every bit good as roots and foliages, whereas the antisense transgene affected merely the limbs of the flower corolla ( Carolyn, 1990 ) .
The terpsichorean and cuneus category forms, which are characteristic of CHS sense transgenotes, have ne’er been seen in antisense flowers ( Carolyn, 1990 ) . There are, nevertheless, a figure of illustrations of similar allelomorphic interactions that could be related mechanistically to co-suppression. One illustration is at the CHS-encoding nivea venue in Antirrhinum majus in which a semi-dominant allelomorph is able to suppress the look of the wild-type allelomorph in trans. This consequence at the Antirrhinum CHS venue, taken together with the petunia CHS co-suppression consequence, suggests that it would be worthwhile to look into the footing of another dominant CHS allelomorph, the C2-ldf allelomorph in corn ( Carolyn, 1990 ) .
Omnipresent works natural merchandises are flavonoids that include seeable pigments ( anthocyanins and chalcones ) , every bit good as colourless UV-absorbing compounds ( flavonols, flavonones, and flavones ) The first measure in flavonoid production is catalyzed by CHS in petunia every bit good as in corn. Recently, Agrobacterium-mediated debut of a CHS transgene into a pigmented inbred petunia stock was reported to stamp down the look of the endogenous CHS cistron ( s ) , ensuing in flower corollas wholly missing flavonoid pigmentation ( Napoli et al. , 1990 ) because the look of the CHS transgene is besides suppressed in these workss. The incorporate transgene Acts of the Apostless like an unlinked dominant inhibitor of the endogenous CHS cistron ( s ) and leads to a complete block in the production of seeable flavonoid pigments non merely in flower petals but besides in generative variety meats ( Taylor et al. , 1992 ) .
In bean ( Phaseolus vulgaris L. ) and other members of the Leguminoseae, chalcone synthase is besides involved in the synthesis of the isoflavonoid- derived phytoalexin antibiotics characteristic of this household ( Thomas et al. , 1987 ) . The monoploid genome of bean contains a household of approximately six to eight CHS cistrons, some of which are tightly clustered. Treatment of bean cells with fungous elicitor activates several of these cistrons taking to the accretion of at least five and likely every bit many as nine distinguishable CHS transcripts encoding a set of CHS isopolypeptides of Mr 42-43 kDa but with differing pH in the scope of pH 6-7 ( Thomas et al. , 1987 ) .
Furthermore, in bean ( Phaseolus vulgaris L. ) and other members of the Leguminoseae, CHS serves a double map since the enzyme is besides involved in the synthesis, in response to wounding and infection, of the isoflavonoid-derived phytoalexins which are characteristic of, and specific to, leguminous plants. complementary DNA ringers incorporating sequences complementary to CHS messenger RNA from irradiated cells and cells treated with fungous elicitor have been identified. They have been used to show that these stimulations activate written text of CHS cistrons taking to increased messenger RNA and enzyme degrees and hence accretion of flavonoid pigments and isoflavonoid phytoalexins severally ( Thomas et al. , 1987 ) .
The efficaciousness of the ihp concept was tested in strawberry fruits by aiming the pigment biogenesis cistron chalcone synthase ( CHS ) that is involved in the biogenesis of the major anthocyanins in strawberry fruit. CHS was chosen as the newsman cistron because decrease of the CHS map utilizing antisense engineering leads instantly to the loss of pigmentation in flowers and fruit, and is therefore easy detected. As a effect of the decreased activity of CHS in strawberry workss transformed with an antisense CHS cistron concept, the degrees of anthocyanins, flavonols and proanthocyanidins were downregulated in the fruit and precursors of the flavonoid tract were shunted to the phenylpropanoid tract ( Thomas et al. , 2006 ) .
The look of the CHS cistron in fruit tissue is reported to be developmentally regulated and associated with fruit coloring and this has been shown in Rubus, apple, whortleberry, pipeline and strawberry. The phenomenon of cosuppression of homologous cistrons was foremost described in petunia, where the debut of an extra CHS cistron resulted out of the blue in workss with wholly white flowers. Additionally, Arabidopsis workss transformed with a CHS-ihpRNA concept showed marked hushing ensuing in the decreased production of flavonoid pigments ( Thomas et al. , 2006 ) .
CHS has been shown to be regulated transcriptionally in response to two environmental signals, UV visible radiation ( in P. hortense and A. majus ) and fungous pathogen intervention. High-intensity light conditions, which induce the accretion of anthocyanin pigments in the foliages and roots of A. thaliana workss, do a attendant addition in the degree of CHS enzyme activity. High-intensity light intervention of A. thaliana workss for 24 Hs caused a 50-fold addition in CHS enzyme activity and an accretion of visibly noticeable degrees of anthocyanin pigments in the vegetive constructions of these workss. A corresponding addition in the steady-state degree of CHS messenger RNA was detected after high-intensity light intervention for the same period of clip ( Rhonda et al. , 1988 ) .
A radical look degree for chs cistrons in a tissue-specific mode in pigmented flowers and roots can be elevated by developmental and environmental cues such as infection by microbic pathogens, UV visible radiation, injuring and interventions with sorts of elicitiors. For illustration, chs cistron from Ginkgo biloba, the look of Gbchs cistron increased during UV-B and injuring interventions which might due to an ague demands for excess pigments in footings of protection from UV or defensive phenoplasts in response to injuring. In add-on, the activities of chs cistrons were reported to be mostly regulated at written text degree. For illustration, chs cistrons from Petroselinum crispum and A. thaliana contained ACGT-containing G-box in their booster parts, which was identified as light-responsive elements ( Yongzhen et al. , 2005 ) .
2.3 Banana
Banana ( Musa ) , a liliopsid works in the household Musaceae originated in South and Southeast Asia, has played interesting and of import functions in the history of human civilisations and besides represent a important portion of human diets in all tropical parts. Banana has evolved in this part, has been introduced and developed until the recent clip in both primary and secondary venue of familial diverseness such as Africa, Latin America, and the Pacific ( Pongsagon, 2008 ) .
Banana works is the beginning of nutrient, drinks, fermentable sugars, medical specialties, flavorer, silages, aromas, ropes, vesture, smoking stuffs, and legion ceremony and spiritual utilizations ( Pongsagon, 2008 ) . Bananas are really rich in saccharides, vitamin C ( besides A and some B vitamins ) , and several of import minerals, including K, P, Cu, Mg, Ca, and Fe.
However, the literature reviews showed that vegetation, cytology, genteelness, gardening, physiology, biochemistry, nutritionary and curative value of banana had been already studied in deepness ( Nor Adlin, 2008 ) . Harmonizing to Maud Grieve ( 1931 ) , the well-thought-of herb doctor, revealed that the banana household is more of involvement for its food than for its medicative belongingss. Each banana contains 74 % H2O, 23 % saccharides, 2.6 % fibre, 1 % proteins and 0.5 % fat ( these values vary between different banana cultivars, grade of ripeness and turning conditions ) ( Nor Adlin, 2008 ) .
2.4 Taxonomy and Classification of Banana
Kingdom: Plant kingdom
Division: Angiospermae
Class: Monocotyledones
Order: Zingiberales Zingiberacea
Family: Banana family
Genus: Musa
Banana is a monocotyledonous works of the household Musaceae, which is composed of the three genera i.e. , Ensete, Musa and Musella. The genus Musa is comprised of 30-40 species and is divided into five subdivisions ; Eumusa, Rhodochlamys, Ingentimusa, Australimusa, and Callimusaa harmonizing to the basic haploid chromosome Numberss. Australimusa, and Callimusaa comprised of about six species each, possess a basic chromosome figure of X=10, while Musa and Rhodochlamys contained about 15 and 6 species, severally, possess that of X=11. Musa ingens is the lone member in the subdivision of Ingentimusa with X=7 ( Kasipong, 2008 ) .
2.4.1 Acuminata cultivars ( AA Genome, seeded )
1. Pisang Kra
2. Pisang Segun
3. Pisang Flava
4. Pisang Sintok
5. Pisang Surong
6. Pisang Rangis
7. Musa acuminata malaccensis ( Lenggeng )
2.4.2 Acuminata cultivars ( AA Genome, comestible )
1. Pisang Mas/ Pisang Mas Besar/ Pisang Mas Kampong/ Pisang Mas Air/ Pisang Minyak ( Kluai Kangsar )
2. Pisang Mas Sagura/ Pisang Perak
3. Pisang Lemak Manis Kelantan/ Pisang Lemak Manis Terengganu/ Pisang Lemak Manis ( Raub ) / Pisang Lemak Manis ( Lipis ) / Mas Pahang
4. Pisang 40 Hari/ Pisang 40 Hari ( Sabah ) / Pisang Boyan/ Pisang Bulin/ Pisang Mas Kertas
5. Pisang Kapas/ Pisang Kapas ( Pontian ) / Pisang Kapas ( Pisang Aur ) / Pisang Pota ( Pisang Aur ) / Pisang Putar ( Ulu Terengganu ) / Pisang Lemak Manis Pahang
6. Pisang Berangan/ Pisang Berangan I/ Pisang Berangan II/ Pisang Jelai Berangan/Pisang Berangan Besi/ Pisang Berangan Buaya/ Lakatan ( Philippines )
7. Pisang Nur ( Kluai Krai )
8. Pisang Lilin
9. Pisang Jari Buaya/ Pisang Lidah Buaya/ Pisang Rotan
10. Pisang Ekor Kuda/ Pisang Kuda
11. Pisang Masam
12. Pisang Jarum/ Pisang Jarum ( Perlis )
13. Pisang Raksa/ Raksa ( Pisang Tioman )
14. Pisang Keladi/ Pisang Pinang/ Pisang Ulat
15. Pisang Serindik/ Gu Nin Chio/ Gu Chi Nio
2.5 Banana Genome
Although the atomic genome of banana ( Musa spp. ) is comparatively little ( 1C ~ 610 Mbp for M. acuminata ) , the consequences obtained from other sequenced genomes suggest that more than half of the banana genome may be composed of insistent and non-coding DNA sequences. Knowledge of insistent Deoxyribonucleic acid can ease function of of import traits, phyletic surveies, BAC-based physical function, and genome sequencing/annotation. However, merely a few insistent Deoxyribonucleic acid sequences have been characterized in banana ( Hrcaronibova et al. , 2007 ) .
2.5.1 Genome Size
The atomic genome of Musa was found to be little with the A genome ( M. acuminate ) being larger than the B genome ( M. balbisiana ) . The consequences suggested that genome size might be used to know apart both genomes. Lysak et al. , ( 2000 ) demonstrated that the B genome is smaller by 12 % on norm utilizing a larger set of diploids.
Among the accessions of M. balbisiana, no intraspecies fluctuation of genome size was found with an mean size of 537 Mbp. On the other manus, the genome size is little but statistically important fluctuation ( 591-615 Mbp ) was found among the races and ringers of M. acuminata. The distinguishable countries of beginning of single accessions of M. acuminata may be reflected by the differences and may be due to fluctuation in the transcript figure of insistent DNA sequences ( Doleel, J. , 2004 ) .
2.5.2 Genome Fundamental law
Genomic fundamental law in Musa has traditionally been determined from morphological parametric quantities. Nuclear DNA content may be used to foretell genomic fundamental law harmonizing to Lysak et al. , ( 2000 ) . However, the differences among single A and B genomes, and/or the engagement of other Musa genomes may compromise the reading of flow cytometric informations. Where labeled genomic Deoxyribonucleic acid is used as a investigation, a powerful alternate attack involves genomic in situ hybridization ( GISH ) . The potency of GISH for Musa was foremost to show by Julian et al. , 1997.
The research workers were able to know apart between chromosomes of A-genome and B-genome beginning in cultivated ringers and unreal loanblends, although significant cross-hybridisation between A and B genome DNA was observed ( Doleel, J. , 2004 ) . Subsequently, Dhonta et al. , ( 2000 ) revealed that the method might besides be used to know apart chromosomes stand foring the S ( M. schizocarpa ) and the T ( M. textilis ) genomes. Musa spp. , in cultivated banana, there are four known genomes, A, B, S, and T. These genomes correspond to the familial fundamental laws of wild Eumusa species M. acuminata, M. balbisiana, M. schizocarpa, M.textilis and the Australimusa species, severally.
Most cultivated ringers have been classified into genomic groups harmonizing to chromosome Numberss and morphological traits, and are triploid or diploid ( Dhonta et al. , 2000 ) . The chromosomes of these four genomes can be differentiated by genome in stiu hybridisation ( GISH ) ; nevertheless, a distal part of the chromosomes remained unlabeled. GISH was used to find the exact genome construction of interspecific cultivated ringers but it can non place the inter-genomic chromosome translocation.
The ringer ‘Pelipita ‘ has the 8-A and 25-B chromosomes alternatively of the predicted 1-A and 22-B which is the noteworthy exclusion. The chromosome complement of a few ringers can be determined utilizing GISH. The research workers revealed that rDNA sites were located in Musa species. They appeared to be frequently associated with orbiters, which can be separated from the chromosomes, stand foring a possible beginning of mistake for chromosome numeration utilizing classical techniques ( Dhonta et al. , 2000 ) .
2.5.3 Chromosome Structure
The construction of Musa chromosomes has been known a small, most of the information comes from the surveies on chromosome coupling during miosis. Local natural state seeded species and races were found to demo regular chromosome coupling with 11 bivalents, bespeaking the absence of noticeable structural heterozygosity. On the other manus, diploid parthenocarpic ringers showed deviant chromosome partner offing with univalents, trivalents, and multivalents, bespeaking heterozygosity for one or more translocations or inversions ( Doleel, J. , 2004 ) .
2.6 Banana Variation and Cultivars
Edible bananas are classified into several chief groups and subgroups. The diploid M. acuminata group ‘Sucrier ‘ has been placed in first by Simmonds, represented in Malaysia, Indonesia, Philippines, southern India, East Africa, Burma, Thailand, the West Indies, Colombia and Brazil. The foliages are xanthous, the sheaths brownish and about free of wax. Ralph bunches are little and the fruits little, huffy and sweet.
Cultivated bananas ( Musa spp. ) are frequently listed in botanical mentions as Musa x paradisiaca ( Musaceae ) , largely diploid or triploid cultivars combinations of the A and B genomes inherited from their diploid ascendants Musa acuminata Colla and Musa balbisiana Colla. The designation of Musa cultivars has traditionally been based upon assorted combinations of morphological, phenological and flowered standards. The combination of genome, for illustration ABB and ABBB occur of course or are produced by unreal hybridisation ( Pillay et al. , 2000 ) . The taxonomy of cultivated bananas has long been a combative issue and it relies to a great extent on morphology ( Brown, 2009 ) .
2.6.1 Pisang Mas
Pisang mom ( Musa acuminata Colla ( AA group ) ) is favored most among all the local sweet bananas because of its intriguing aureate Peel and xanthous mush, good olfactory property every bit good as sweet gustatory sensation. It is a native Malayan banana known as “ pisang mom ” in Malay, which has the interlingual rendition of “ aureate banana ” ( pisang = banana, mas = aureate ) .
2.6.2 Wild Type
The two genera, Musa and Ensete, of which Musa encompasses wild and domesticated bananas and plantains. Domesticated bananas are parthenorcarpic and by and large seedless. Seeded Musa acuminata ( Genome AA ) became the primogenitor of parthenorcarpic AA diploid ringers and of AAA triploids. The great bananas of international commercialism ( Cavendish ) are an AAA triploid derived from pure Musa acuminata.
The chief domestication of pure acuminata types was likely found in Malaysia and neighbouring islands and countries as far east as the Indo-Chinese peninsula ( Farmer ‘s cognition of wild Musa in India ) . The bulk of domesticated bananas, nevertheless, are of intercrossed beginning between Musa acuminata and the other major wild species in Eumusa, Musa balbisiana ( Genome BB ) . They are either AB, AAB, or ABB in genomic footings. The cardinal mutant required to change over wild banana fruit into readily consumable fruit was parthenorcarpic.
This trait is governed by one or a few cistrons and it enables the fruit to make full with mush even in the absence of pollenation. This is different from seedlessness, which is governed by other cistrons, or induced by triploidization. Parthenorcarpic must hold occurred many times in Musa acuminata which bit by bit became less seedy as other mutants occurred for seedlessness or as triploids occurred of course ( Farmer ‘s cognition of wild Musa in India ) .
2.7 Fruiting
Fruiting exacts a immense energy toll from the female parent works that needs a batch of N and wet to prolong it. After a chaff of bananas has developed, it may be 6 to 7 months before the fingers are mature. The fruits ( “ fingers ” ) are formed in beds called combs or custodies, each manus has a Crown to which 10 to 20 fingers are attached and there are 6-15 combs per chaff, which equals 40-50 kgs per chaff or ten or more dozenss per acre per twelvemonth.
The fruits are attached to the peduncle by pedicels. The amount of fruits in the blossoming is known as the clump, single bunch of fruits is known as manus, and single fruit is called finger ( Nor Adlin, 2008 ) . Morphology of the developing banana fruits both seeded and parthenorcarpic assortments were already studied ( Tripathil, 2003 ) . Peel cells consist of an outer cuticle and cuticle, several beds of hypodermal parenchyma and parenchyma cells interspersed with latex vass, vascular packages, and air infinites.
In add-on, the hydrodermal cells and the innermost mush – initiating cells tend to be smaller and more tightly packed than the other cells. Pulp cells consist of a big Numberss of amylum grains in mature, pre-climacteric tissue. During maturing, the mush cells become increasingly depleted of amylum and single cells can be revealed in inside informations. An green banana has high amylum and low sugar degrees plus voluminous sums of bitter-tasting latex. Starch is converted to saccharify as the fruit ripens, so that bananas can finally hold approximately 25 % sugar.
The latex is besides broken down, as the banana ripens. This survey besides reveals the significance part of the Peel to the overall metamorphosis of the banana fruit. Large proportion of peel tissue makes up approximately 80 % , 40 % and 33 % of the fresh weight of juvenile, mature and to the full mature fruit, severally. Harmonizing to Espino et al. , ( 1992 ) as the fruit grow, the pulp/skin ratio will lift steadily. Presence of of course formed ethene gas, produced by ripen fruits, hastens the maturation of environing, greener fruits, which is enabled to rush the yellowing of green fruits. Ethylene gas can be used commercially to do green bananas to get down maturation ( Nor Adlin, 2008 ) .
The fruit of a banana is a berry with a leathery outer Peel that contains much collenchyma. Among the comestible bananas, the lone of import diploid of M. acuminatais ‘Sucrier ‘ which fruit is sweet and huffy. The major triploid bananas, ‘Gros Michel ‘ or cultivars derived from “ Cavendish ” stock that is shipped. In Central America, ‘Gros Michel ‘ and ‘Poyo ‘ Cavendish were wiped out virtually nightlong by Panama disease, a fungus ( Fusarium oxysporium cubense ) , which attacks the bast. Fortunately, some banana ringers showed opposition in the field, and agriculturists reestablished plantations with those workss ( Tripathil, 2003 ) .
Presents, the Jamaican ringer ‘Valery ‘ ( a robust Cavendish banana ) is grown widely in Central America, because it is immune to Panama disease. M. balbisiana Colla of southern Asia and the East Indies bears a seedy fruit but the works is valued for its disease-resistance and therefore dramas an of import function as a “ parent ” in the genteelness of comestible bananas. The fruit ( technically a “ berry ” ) turns from deep-green to yellow or red, or, in some signifiers, green-and white-striped, and may run from 2.5 to 12 in ( 6.4-30 centimeter ) in length and 3/4 to 2 in ( 1.9-5 centimeter ) in breadth, and from oblong, cylindrical and blunt to pronouncedly 3-angled, slightly curved and hornlike ( Morton, 1987 ) .
The flesh, ivory-white to yellow or salmon-yellow, may be steadfast, styptic, even gummy with latex, when unripe, turning stamp and slippery, or soft and laid-back or instead dry and mealy or starchy when ripe. The spirit may be mild and sweet or subacid with a distinguishable apple tone. Wild types may be about filled with black, difficult, rounded or angled seeds 1/8 to 5/8 in ( 3-16 millimeter ) broad and have scant flesh. The common cultivated types are by and large seedless with merely infinitesimal traces of ovules seeable as brown pinpoints in the somewhat hollow or faintly sententious centre, particularly when the fruit is overripe. Occasionally, cross-pollination by wild types will ensue in a figure of seeds in a usually seedless assortment such as ‘Gros Michel ‘ , but this has ne’er been reported in the Cavendish type ( Morton, 1987 ) .
2.8 Parthenocarpy
Parthenorcarpic fruits are luck of embryo and endosperm. In nature, such fruits occur with frequence has been a enigma because they do non give feasible progeny and therefore do non lend straight to fittingness. In general, about 20 per centum of the fruit harvest can be parthenorcarpic. In vegetation, the term parthenorcarpic is the development of the ovary of a flower into a fruit formation without fertilisation by pollen. Naturally, it may happen spontaneously in some workss, for illustration, banana and in other workss can be induced by application of auxins. It can besides be induced in some fruit harvests, either by engendering or by using certain works endocrines.
The fruits that develop parthenocarpically are typically seedless and hence do non lend to the reproduction of the works, illustrations are bananas and Ananas comosuss ( Dhonta et al. , 2000 ) . Bananas are parthenocarps and the comestible banana is the fruit of a unfertile loanblend. The banana works grows as a series of chumps from a rootstock. Each root bit by bit droops downwards and produces at its tip the male flowers, which are unfertile. The female flowers produce the comestible fruits without fertilisation. The works dies, after a root has produced a harvest of fruit and is replaced by a new root from a bud farther along the rootstock.
A banana works may populate for over 60 old ages. Some seedless fruits come from unfertile triploid workss, with three sets of chromosomes instead than two. The triploid seeds are obtained by traversing a fertile tetraploid ( 4n ) works with a diploid ( 2n ) works. The triploid seeds are larger, and both types of seeds are planted in the same locality. Male flowers of the diploid works provide the pollen which pollinates ( but does non fertilise ) the unfertile triploid works.
Most bananas at local supermarket came from unfertile triploid loanblends ( Tripathil, 2003 ) . Common cultivated bananas are normally triploid ( 3n ) with three sets of chromosomes. If A represents one haploid set of chromosomes from diploid M. acuminata ( AA ) and B represents one haploid set of chromosomes from diploid M. balbisiana ( BB ) , so intercrossed bananas have three sets of chromosomes represented by AAB, ABB or another 3-letter ( triploid ) combination of A ‘s and B ‘s.
Cultivated bananas are wholly unfertile and do non bring forth mature seeds except aborted ovules inside the fruit that appear like bantam black points. As literature reappraisals, bananas are unfertile and seedless because one set of chromosomes ( A or B ) has no homologous set to partner off up with during synapsis of miosis. Therefore usually miosis does non continue, and feasible gametes ( sex cells ) are non produced. Banana workss must be propagated vegetatively ( asexually ) by seting corms, pieces of corms or chump sprouts without seeds ( Tripathil, 2003 ) .
In Musa, the fact that triploid cultivars are seedless, about unfertile and they develop fruit by parthenocarpy but it is besides a restraint when it comes to better their output and opposition to biotic emphasiss. Breeders ever aim to acquire parthenocarpic loanblends with enhanced opposition. Simmonds ( 1959 ) reported that parthenocarpy is controlled by at least three independent complementary dominant cistrons ( V. Krishnamoorthy, 2004 ) .
The analysis of parthenocarpy and asepsis in the comestible diploids is the key to understand banana development ( Rodomiro, 1995 ) . Simmonds pointed out those seedless comestible bananas are the merchandise of two evolutionary procedures: parthenocarpy and asepsis, nevertheless, really few familial markers are available in banana and plantain as a consequence of a deficiency of heritage surveies ( Rodomiro, 1995 ) . In this experiment, Musa acuminata partial chs cistron for putatative chalcone synthase was focused to analyze the differential look degrees of this cistron in wild type and cultivated banana, Mas.
2.9 Influence of Chalcone Synthase cistron in Banana
The enzyme, chalcone synthase is polar for the formation of seed during the fruit development. The old survey has proved that downregulation of the flavonoid biogenesis tract utilizing RNA intervention ( RNAi ) -mediated suppression of chalcone synthase ( CHS ) , the first cistron in the flavonoid tract can do parthenocarpy of the tomatoes. In CHS RNAi workss, entire flavonoid degrees, transcript degrees of both Chs1 and Chs2, every bit good as CHS enzyme activity were reduced by up to a few per centum of the corresponding wild-type values ( Elio et al. , 2007 ) .
The ensuing transgenic fruits showed a strong lessening of entire flavonoid degrees and displayed an altered colour. Consequently, these fruits were devoid of seeds. In add-on to ( male ) asepsis, parthenocarpy, which is defined as the formation of seedless fruits in the absence of functional fertilisation ( Gustafson, 1942 ) , is a desirable trait for several of import harvest workss. Unfortunately, mutants doing parthenocarpic fruits every bit good as works hormone-based attacks to obtain parthenocarpy frequently have pleiotropic effects and can ensue in unwanted features, such as deformed fruits ( Elio et al. , 2007 ) .
In some workss, flavonoids, play a important function in birthrate and sexual reproduction. For illustration, suppression of flavonoid production in Petunia workss, through antisense suppression of the cistron encoding chalcone synthase ( CHS ) , resulted non merely in the suppression of flower pigmentation but besides in male asepsis ( Van der Meer, 1992 ) . Further grounds for a function of flavonoids in sexual reproduction is provided by the male unfertile Petunia white anther ( wha ) mutation, which could be complemented by the debut of a functional CHS complementary DNA ( Napoli, 1999 ) . Therefore, mutant of chalcone synthase cistron might be related to the formation of parthenocarpic in banana ( Elio et al. , 2007 ) .
Chapter 3
MATERIALS AND METHODS
3.1 Plant Materials
Two species, Pisang Mas, Musa acuminata Colla ( AA group ) and wild type, Musa acuminata malaccensis were chosen for the experiment. Pisang Mas samples were obtained from Multicore Sdn Bhd, Johor Baru, Malaysia and wild type samples were collected from the locality of Palapes, Universiti Malaya, Kuala Lumpur, Malaysia. The foliages, stems, roots, flowers ( male bud ) and fruits from both Mas and wild type were selected prior to RNA extraction.
Musa species and cultivars have been widely studied by several research workers ; nevertheless, the possible nexus between mutants in chalcone synthase cistron and parthenocarpy in banana has non studied ( Foo, 2009 ) . Therefore, in this experiment, different parts of samples such as foliage, root, root, flower and fruit from each mature workss were chosen to analyze the differential cistron look degrees of different tissues in banana.
3.2 RNA Extraction
Alteration of a CTAB method by ( Ying, 2002 ) was used to transport out RNA extraction from both wild type and Mas samples. 15 mL extraction buffer was pre-warmed to 65°C in a H2O bath by adding 20µl ?-mercaptoethanol. 0.4-0.7g of different tissues was land in a howitzer utilizing liquid N. The frozen pulverization was rapidly transferred to the pre-warmed extraction buffer and assorted wholly by inverting the tubing. The mixture was incubated at 65°C for 10 min with vigorous agitating several times.
An equal volume of chloroform-isoamylalcohol was added and shaken smartly. Then the tubings were centrifuged at 10,000 g for 10 min at 4°C. The really syrupy supernatant was transferred to a new tubing and re-extracted with an equal volume of chloroform-isoamylalcohol. Then, centrifuged as above. The supernatant was collected really easy and carefully to avoid taking the cell lysates in trichloromethane. Then, the supernatant was centrifuged at 30,000 g for 20 min at 4°C to precipitate the pellet and fling the indissoluble stuff. 0.25 vol of 10 M LiCl was added to the supernatant, assorted good, and stored at 4°C overnight. The RNA was recovered by agencies of centrifugation at 30,000 g for 30 min at 4°C. The syrupy supernatant was wholly discarded and washed the pellet with 75 % ethyl alcohol 3 times to take the staying and air dried it for 10 min. The RNA was dissolved in DEPC-treated H2O and stored the RNA at -80°C until usage.
3.3 RNA Analysis
The RNA was analyzed utilizing the standard methods for agarose gel cataphoresis ( Sambrook et al. , 1989 ) . The RNA measure and quality was further estimated spectrophotometrically by bio photometer, ( eppendorf, Germany ) at the optical density ratios of A260/280.
3.4 Gel Electrophoresis
Gel cataphoresis is a widely used technique for the analysis of nucleic acids and proteins. Almost every molecular biological science research research lab routinely uses agarose gel cataphoresis for the readying and analysis of DNA/RNA. Electrophoresis is a method of dividing substances based on the rate of motion while under the influence of an electric field.
Agarose is a polysaccharide purified from seaweed. Several factors act upon how fast the RNA moves, including the strength of the electrical field, the concentration of agarose in the gel and most significantly, the size of the RNA molecules. Smaller RNA molecules move through the agarose faster than larger molecules. RNA itself is non seeable within an agarose gel. The RNA will be visualized by the usage of a dye that binds to RNA.
3.4.1 Preparation of 1 % Agarose Gel
The armored combat vehicle and column were rinsed with 70 % ethyl alcohol and so washed with TBE which is already diluted into 1X TBE buffer from the 10X TBE buffer stock. 350mg of agarose pulverization was dissolved in 35ml of 1X TBE and boiled utilizing micro-cook oven about 1 min. The agarose mixture flask was cooled down under running tap H2O. 1µl ethidium bromide was added and so poured it into the gel rack and the comb which is inserted into the other side of the gel rack. The comb was removed when the gel was solidified and put into the chamber with 1X TBE.
Then, 2 µl of 100bps DNA ladder was injected into the first good, 2µl of different RNA samples were assorted with lading dye and injected into the 2nd, 3rd and the undermentioned Wellss. During cataphoresis, the gel was submersed in a chamber incorporating a buffer solution and a positive and negative electrode and the current was applied at 120V for 25 min. The RNA to be analyzed is forced through the pores of the gel by the electrical current. Under an electrical field, RNA will travel to the positive electrode ( ruddy ) and off from the negative electrode ( black ) . Then, the gel was analyzed by utilizing Geldoc AlphaImagerTM 2200, ( Alpha Innotech, U.S.A ) .
3.5 DNase Treatment
Accurate finding of entire RNA concentration is peculiarly of import for absolute quantification of messenger RNA degrees where messenger RNA transcript Numberss are best normalized against entire RNA and any important DNA taint will ensue in inaccurate quantification ( Bustin, 2002 ) . Many research workers are loath to expose their cherished RNA samples to DNase intervention that the residuary RNases will degrade it or impact its long-run storage. If cherished samples are to be DNase-treated, it is necessary to guarantee that the DNase is removed prior to any RT measure.
3.5.1 Preparation of RNA sample prior to RT-PCR
3µl DNase 1 reaction buffer, 2µl dH2O, and 1mg RNA sample were added to the eppendorf tubings and incubated in room temperature for 15 min. Then, 3µl EDTA ( halt solution ) was added to each tubings and incubated in H2O bath for 65, 10 min. Then, all the DNase treated samples were ready to run the gel cataphoresis.
3.5.2 Deoxyribonuclease 1, Amplification Grade
Deoxyribonuclease 1, Amplification Grade ( DNAse 1, Amp Grade ) was obtained from Invitrogen, UK. It digests individual and double-stranded Deoxyribonucleic acid to oligodeoxy-ribonucleotides incorporating a 5 ‘ phosphate. It is suited for extinguishing DNA during critical RNA purification processs such as those anterior to RNA-PCR elaboration. DNase 1, Amp Grade is purified from bovine pancreas and has a specific activity of ? 10,000 U/mg.
3.6 Reverse written text
The RT measure is critical for sensitive and accurate quantification and the sum of complementary DNA produced by the rearward RNA polymerase must accurately stand for RNA input sums. The rearward RNA polymerase enzyme is sensitive to salts, intoxicants or phenol staying from the RNA isolation ( Willard et al. , 1999 ) . Therefore, the dynamic scope, sensitiveness and specificity of the enzyme are premier considerations for a successful RT-PCR check. Protocols utilizing a one tube/one or two enzyme-based attacks are significantly more convenient than those utilizing two tube/two enzyme based protocols but have been reported to be less sensitive ( Bustin, 2002 ) .
RT reactions are normally carried out between 40 and 50 and at these low temperatures there can be jobs with the comparative nonspecificity of the RT reaction ( Bustin, 2002 ) . This consequences in non-specific priming by both frontward and change by reversal primers and is a peculiar job with really low concentrations of get downing templet. This is because such templets can do the enzyme to halt, dissociate from the RNA templet, or skip over looped-out parts of RNA. To prove the claim, High Capacity cDNA Reverse Transcription Kit ( 200 Reactions ) was used in this experiment to fix complementary DNA from entire RNA isolated.
3.7 Reverse written text – Polymerase Chain Reaction ( RT-PCR )
RT-PCR ( rearward transcription-polymerase concatenation reaction ) is the most sensitive technique for mRNA sensing, quantitation and powerful tool for analysing RNA. Compared to the two other normally used techniques for quantifying RNA degrees, Northern smudge analysis and RNase protection check, RT-PCR is finely sensitive, allowing analysis of cistron look from really little sums of RNA even at the degree of the content of a individual cell ( Willard et al. , 1999 ) .
In fact, this technique is sensitive plenty to enable quantification of RNA from a individual cell. RT-PCR may besides be used in cloning, building a complementary DNA library, magnifying signal during in situ hybridisations, and synthesising investigations. The first portion of the reaction, rearward transciption, synthesizes complementary DNA from RNA and the 2nd measure amplifies the synthesized complementary DNA to easy noticeable degrees. Deoxyribonucleic acid primers are specific to the messenger RNA sequence and the DNA sequence to be amplified and are needed in order for the right span of Deoxyribonucleic acid to be amplified.
3.7.1 cDNA Reaction Preparation
The High Capacity cDNA Reverse Transcription Kit ( 200 Reactions ) was obtained from Applied Biosystems, USA, contains all constituents necessary for the quantitative transition of up to 2µg of entire RNA in a individual 20µL reaction to individual stranded complementary DNA. The kit includes Random Primers, optimized RT Buffer, dNTP ‘s and MultiScribe™ MuLV contrary RNA polymerase. Chemical reactions can be scaled up to 100 µL to bring forth 10 µg of complementary DNA from a individual reaction. The kit contains reagents that when combined from a 2X Reverse Transcription ( RT ) Master Mix. An equal volume of RNA sample was added and RNase-free reagents and consumables were used to avoid Rnase taint.
3.7.1.1 Preparation of 2X RT Master Mix ( per 20µl reaction )
2 X RT Master Mix readyings were carried out by utilizing a typical check harmonizing to the maker ‘s instructions. This is performed in 0.2ml thin-walled PCR tubing, in a concluding volume of 20µl.
3.7.1.2 Preparation of the complementary DNA Reverse Transcription reactions
10µl of 2 X RT maestro mixes was pipette into each well of a 96-well reaction home base or single tubing. Then, 10µl of RNA sample was pipette into each well, pipetting up and down two times to blend. The home bases or tubings were sealed and briefly centrifuged the home base or tubings to whirl down the contents and to extinguish any air bubbles. The home bases or tubings were placed on ice until to lade the thermic cycler.
3.7.2 complementary DNA Synthesis
The complementary DNA synthesis is carried out in the thermo cycler at 25 for 10 min, 37 for 120 min, 85 for 5 min and 4 clasp utilizing High Capacity cDNA Reverse Transcription Kit.
3.8 Primer Design
Musa acuminata partial chs cistron for putatative chalcone synthase cistron sequence is available at the NCBI ( National Center for Biotechnology Information ) Gene Bank ( www.ncbi.nlm.nih.gov ) . Multiple alignment analysis was done by utilizing ClustalW2 ( www.ebi.ac.uk/clustalw ) . Three sets of primer was designed from Musa acuminata partial chs cistron for putative chalcone synthase with accession no. AM259305 utilizing primer 3 package provided by applied biosystem Real-time 7500 machine.
The primer-designed sequences are as follow:
Forward Primer
5 ‘ CTCGCCATGTTCCCGTACTC 3 ‘
Change by reversal Primer
5 ‘ AGCGACTGGAACTCCATATTCTG 3 ‘
Forward Primer
5 ‘ CGCCATGTTCCCGTACTCTT 3 ‘
Change by reversal Primer
5 ‘ TCAGCGACTGGAACTCCATATTC 3 ‘
Forward Primer
5 ‘ TCCACAACGACGGATATCAATG 3 ‘
Change by reversal Primer
5 ‘ GCAGCGTGCTGTTCATCCT 3 ‘
Table 3.1 RT-PCR mixture contents.
Component
Volume ( µl ) /Reaction Kit
With Rnase Inhibitor Kit
Without Rnase Inhibitor
10X RT Buffer
2.0
2.0
25X dNTP Mix ( 100mM )
0.8
0.8
10X RT Random Primer
2.0
2.0
MultiScribeTM Reverse Transcriptase
1.0
1.0
Rnase Inhibitor
1.0
–
Nuclease-free H2O
3.2
4.2
Entire per Chemical reaction
10.0
10.0
Table 3.2 RT-PCR conditions.
Measure 1
Measure 2
Measure 3
Measure 4
Temperature
25
37
85
4
Time
10 min
120 min
5 min
–
3.9 Real-time PCR
Real-time PCR is a powerful and rapid technique for elaboration and quantitation of mark nucleic acids. The accretion of specific merchandises in a reaction is monitored continuously during cycling. This is normally achieved by supervising alterations in fluorescence within the PCR tubing. Besides TaqMan® , there are two other types of fluorescence monitoring chemical sciences available for real-time PCR methods, the molecular beacon method and the SYBR® Green method.
To analyze the differential look degrees of CHS in wild-type and cultivated bananas, Real-time PCR was performed utilizing Real-time Quantitative PCR 7500 ( Applied Biosystmes, U.S.A ) in the presence of SYBR-green. The optimisation of the real-time PCR reaction was performed harmonizing to the maker ‘s instructions ( Applied-Biosystems, SYBR-Green I reagent protocol ) . The PCR conditions were standard ( SYBR-Green I reagent protocol ) and all reagents were provided in the SYBR-Green I reagent kit.
3.9.1 Quantitative real-time PCR Assay
Quantitative real-time PCR was used to assay the specific look of CHS cistron in different tissues of banana. 96-well Optical Reaction Plate are obtained from Applied Biosystems, U.S.A. SYBR Green PCR Master Mix is obtained from Applied Biosystems, UK. 8-well PCR tube-strips are obtained from Applied Biosystems, U.S.A and the optical adhesive screen from Applied Biosystems, U.S.A.
3.9.2 SYBR Green ²
In this experiment, the DNA intercalating dye, SYBR Green 1 was used as the newsman fluorophore. It works like ethidium bromide by adhering double-stranded DNA, which is the merchandise of the PCR. As the reaction rhythm advancement, the instrument proctors and records the addition in fluorescence over clip. In add-on to the regular PCR constituents, the SYBR Green assay merely requires a validated primer brace. One advantage of SYBR Green compared to TaqMan is that the initial check readying requires merely a few yearss for primer design and proof.
SYBR Green have a little border in sensitiveness at & gt ; 10 transcripts because the newsman dye binds to any double-stranded DNA nowadays in the reaction, and does non necessitate a probe-cleavage event for the fluorescence sensing, as does TaqMan. The consequence is detected at earlier rhythms of the PCR merchandise. This is critically of import in the instance of low-abundance transcripts ( & gt ; 10 transcripts ) , where the figure of PCR rhythms required for fluorescence sensing above background might be beyond the scope of rhythms in the TaqMan, but non the SYBR check.
The disadvantage of SYBR Green over TaqMan is the double-stranded DNA binding belongings because non-specific merchandises and messenger RNA with high sequence individuality may be detected ( Angie et al. , 2003 ) .
3.9.3 Endogenous Normalizer
One of the experimental controls either lading or internal control is included in a gene-expression check. It is used to normalise the signal value of each sample so that the differences between samples are the consequence of a existent biological difference and non because of inconsistent burden. Housekeeping cistrons are the typical pick harmonizing to their largely consistent look degrees in all cell types. Glyceraldehydes 3-phosphate dehydrogenase ( GAPDH ) , ?-actin, cyclophilin, and 18S rRNA is normally used ( Angie et al. , 2003 ) . In this experiment, ?-actin ( FW: 5 ‘ GGAATTCCTCCAGCTGCCACTTACTCC 3 ‘ ; Rev: 5 ‘ AGAGCTCTTGAGCAGG GTAGCACTCTTGG 3 ‘ ) was used as typical housekeeping cistron.
Chapter 4
Consequence
4.1 RNA Extraction
High-quality entire RNA was obtained by utilizing the CTAB modified RNA isolation method ( Ying, 2002 ) . The scope of outputs of entire RNA ( µg/µl ) from the different parts of the works were as follows: 555-2917 for foliage, 494-1866 for root, 455-1469 for root, 812-1916 for flower, and 658-684 for fruit tissues ( Table 4.1 ) . The extraction protocol used was efficient in giving a high quality and measure of entire RNA from all the banana tissues and phases tested. However, mature banana tissues dwelling of foliage, root, root, flower ( male bud ) and fruit ( mush ) produced higher-quality and higher-yield of entire RNA, which was sufficient for complementary DNA library building.
To roll up adequate entire RNA, it was necessary to pull out RNA from 400-700 milligram of mature foliage, root, root, fruit ( mush ) and flower ( male bud ) severally. The entire RNA and any debasement in the RNA readying were easy visualized on an EtBr agarose gel. The RNA unity was assessed by the acuteness of ribosomal RNA bands visualized on an EtBr agarose gel.
For all wild-type RNA samples tested, distinguishable 28S and 18S RNA sets without any smearing and debasement were observed ( 4.1 ( A ) ) . For all Mas samples RNA extraction yielded high-quality entire RNA were indicated by crisp sets of big fractional monetary unit RNA ( 4.2 ( A ) ) . For all samples, OD A260/280 ratios ranged from 1.7-2.15, bespeaking that the RNA was of high pureness, with minimum protein taint, polyphenol and polysaccharide taint ( Table 4.1 ) .
Table 4.1 RNA output and quality utilizing spectrophotometry.
Banana Tissue
Speciess
Absorbency Ratios
OD A260/280
Output
mg/µl
Leaf
Root
Root
Flower
( male bud )
Fruit
( mush )
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
2.01
2.08
2.12
1.70
2.12
1.84
1.88
2.15
1.92
1.70
0.555
2.917
0.494
1.866
0.455
1.469
0.812
1.916
0.684
0.658
A.
B.
4.1 ( A ) Agarose gel cataphoresis of entire RNA from Musa acuminata malaccensis ( Wild-type ) ; Lane 1, foliage ; Lane 2, Stem ; Lane 3, Root ; Lane 4, Flower ( male bud ) ; Lane 5, Fruit ( mush ) ; M, Low Range RNA marker ( Fermentas ) . ( B ) Agarose gel cataphoresis of entire RNA from Musa acuminata malaccensis ( Wild-type ) after DNase intervention ; Lane 1, foliage ; Lane 2, Stem ; Lane 3, Root ; Lane 4, Flower ( male bud ) ; Lane 5, Fruit ( mush ) ; M, Low Range RNA marker ( Fermentas ) .
4.2 DNase intervention
The extracted RNA could be used for farther analyses as demonstrated by complementary DNA library building and RT-PCR. To obtain pure RNA from the initial entire nucleic acid infusions, DNA was selectively removed by the usage of Deoxyribonuclease1Amplificaton Grade ( DNase 1 Amp Grade ) which proved to be more efficient than other methods.
The DNase digestion measure resulted in wild-type RNA infusions that were free of DNA upon ocular review after gel cataphoresis ( 4.1 ( B ) ) . The DNase intervention consequences of entire RNA from Mas samples were clearly demonstrated by crisp sets after gel cataphoresis ( 6.2 ( B ) ) . After synthesis of complementary DNA normalized complementary DNA libraries were successfully constructed from foliage, root, root, flower ( male bud ) and fruit ( mush ) tissues.
4.2 ( A ) Agarose gel cataphoresis of entire RNA from Musa acuminata Colla ( Mas ) ; Lane 1, foliage ; Lane 2, Stem ; Lane 3, Root ; Lane 4, Flower ( male bud ) ; Lane 5, Fruit ( mush ) , M ; 100bp Deoxyribonucleic acid Ladder. ( B ) Agarose gel cataphoresis of entire RNA from Musa acuminata Colla ( Mas ) after DNase intervention ; 1, foliage ; Lane 2, Stem ; Lane 3, Root ; Lane 4, Flower ( male bud ) ; Lane 5, Fruit ( mush ) ; M, Low Range RNA marker ( Fermentas ) .
4.3 complementary DNA Quality and Yield
Using the modified conditions, 450-3000µg sum RNA was obtained from 400mg fresh samples. The A260/A280 ratios systematically ranged from 1.75-2. The quality of the RNA was besides demonstrated utilizing RT-PCR. Table 4.2 shows the high quality complementary DNA concentration and pureness. Using the High Capacity cDNA Reverse Transcription Kits ( Applied Biosystems ) , we successfully cloned full-length complementary DNA with high-sequence similarity to Musa acuminata partial chs cistron for putatative chalcone synthase as verified by a database hunt. A similar amplicon ( informations non shown ) was obtained from entire RNA as templet.
Therefore, this fragment was used as templet to transport out real-time quantitative PCR for farther analysis of cistron look. For each new works species being studied, RNA isolation protocols have to be adjusted and optimized ( Ying et al. , 2002 ) . Even the simplest alterations have proved to be efficient as in the instance described here.
Table 4.2 complementary DNA output and quality utilizing spectrophotometry.
Banana Tissue
Speciess
Absorbency Ratios
OD A260/280
Output
ng/µl
Leaf
Root
Root
Flower
( male bud )
Fruit
( mush )
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
1.88
1.74
1.92
1.89
1.81
1.94
1.76
1.76
1.81
1.79
2107.6
2292.0
2021.7
2085.2
2399.0
1930.1
2557.0
3270.6
3041.6
1940.2
4.4 Expression of CHS cistron in wild type and cultivated banana ( Mas )
To look into the parthenocarpic formation in unseeded banana and differential cistron look degrees in both wild type and cultivar ( Mas ) which is likely to be related to the mutant in chalcone synthase cistron and parthenocarpic in banana, different complementary DNA of fruit ( mush ) , flower, foliage, root and root samples were studied utilizing real-time quantitative PCR 7500 ( Applied Biosystems ) in the presence of SYBR-green.
Quantitative real-time PCR analysis revealed an copiousness of CHS transcripts in all samples of both wild type and Mas. The highest degrees of CHS transcripts were detected in root ( control ) which is higher than all of the samples and even other controls. Some members of the CHS multigene household are expressed in foliages, fruit ( mush ) , flower, root and root samples of wild type, malaccensis. CHS tra
