Designation and Characteristics of a Testis-Specific Gene, Ccdc38 in Mice
Shouren Lin1 #, Yuchi Li1,2 #, Manling Luo1,2, Huan Guo1,3, Jianbo Chen1,4, Qian Ma1, Yanli Gu1, Fangting Zhang5, Zhimao Jiang1, Yaoting Gui1*
1Guangdong and Shenzhen Key Laboratory of Male Reproductive Medicine and Genetics, Institute of Urology, Peking University Shenzhen Hospital, Shenzhen PKU-HKUST Medical Center, Shenzhen, 518036,P.R.China
2Shantou University Medical College, Shantou, 515041,P.R.China
3Guangzhou Medical University, Guangzhou, 510182,P.R.China
4Anhui Medical University, Hefei, 230032,P.R.China
5Department of Clinical research lab, Peking University Shenzhen Hospital, Shenzhen 518036,P.R.China
# Shouren LinandYuchi Lihold contributed every bit to this work
Correspondence should be addressed to Y Gui ; Email:guiyaoting2007 @ aliyun.com
Abstraction
Qualifying and comparing the testis-specii¬?c cistrons in different species can uncover cardinal cistrons related to testis-specii¬?c maps and supply auxiliary information for survey and intervention of human sterility. Here, we have identified a testis-specific cistron, Ccdc38 ( Coiled-coil sphere incorporating 38 ) , by testing of UniGene libraries databases. Systematic bioinformatics analysis showed CCDC38 is conserved in mammalian species. We found CCDC38 was entirely expressed in mouse testicles and its look was increased in an age-dependent mode from postpartum 2 hebdomads to 8 hebdomads by utilizing quantitative RT-PCR ( qRT-PCR ) and Western smudge, which indicated that CCDC38 may be associated with the meiotic procedure. Further immunohistochemistry analysis revealed that CCDC38 was chiefly expressed in the spermatogonia and spermatocytes. The most of import, immunofluorescence and co-immunoprecipitation ( Co-IP ) assays validated that CCDC38 interacted with ubiquitinated H2A ( uH2A ) in mouse testicle. Take together, these consequences suggested thatCcdc38is a testis-specific cistron and may play a function in mouse spermatogenesis.
Keywords:Ccdc38, Testis, Spermatogenesis, Ubiquitinated H2A
- Introduction
Sterility has affected every bit many as 15 % of twosomes worldwide, and males are known to be responsible for half of the cases [ 1 ] . As molecular mechanisms commanding male birthrate remain ill understood, the curative attacks to male sterility are non good developed [ 2 ] . Therefore a more complete apprehension of the physiological mechanisms in spermatogenesis is needed before solutions to the job can be resolved.
Spermatogenesisis a complex developmental procedure in which uniform spermatogonia are differentiated into spermatocytes and spermatids through two unit of ammunitions of meiotic division and eventually giving rise to maturate sperm [ 3 ] . Defects in any one of these three procedures could ensue in sterility. This complex procedure is orchestrated by the look of 1000s of cistrons encoding proteins that play indispensable functions during specific stages of source cell development. Many of these cistrons are expressed preponderantly or entirely in spermatogenic cells, and their ordinance can affect control at the transcriptional or post-transcriptional degree. The designation of testis-specific or germ cell-specific cistrons involved in these alone events provides first-class tools to dissect the distinction plan and to analyze the mechanisms by which spermatogenesis is controlled. To day of the month, many testis-specific cistrons have been identified in human and mouse, e.g.AKAP3[ 4 ] ,Lfg5[ 5 ] ,Fank1[ 6 ] ,Prss41[ 7 ] ,Spata33[ 2 ] ,Tssk4[ 8 ] . In add-on to the cistrons mentioned above, other testis-specific cistrons may be and function alone maps in the testicle.
Ccdc38was chose from the expressed sequence ticket ( ESTs ) obtained by comparing testicle libraries with the libraries of other tissues and cell lines utilizing the DDD plan [ 9 ] . Its EST profile in Unigene ( Mm.477086 ) showed thatCcdc38transcript was detected merely in mouse testicle, which was consistent with its study at BioGPS.org [ 10 ] .Ccdc38orthologs are present in other species including the rat ( Gene ID: 500823 ) , cow ( Gene ID: 517752 ) , and in assorted Primatess, including Pan troglodytes ( Gene ID: 738083 ) and worlds ( Gene ID: 120935 ) .
Previously, we characterized the cistron look profiles of 2058 spermatogenesis-related cistrons in mice by executing large-scale complementary DNA analysis utilizing GeneChip Mouse Genome 430 2.0 [ 11 ] , and a figure of fresh cistrons were identified and characterized [ 12-14 ] . Here, as an on-going survey on testis-specii¬?c cistrons, we identified a cistron,Ccdc38, which was merely expressed in mouse testicle. The protein of this cistron is chiefly expressed in spermatogonia and spermatocytes. Furthermore, we found that CCDC38 can interact with uH2A in mouse testicle. To the best of our cognition, this is the i¬?rst study on the survey ofCcdc38,a testis-specific cistron with a possible function in mouse spermatogenesis.
2. Materials and Methods
2.1. Samples. Male and female Balb/c mice ( aged 4 – 6 hebdomads ) were obtained from Laboratory Animals Center of South Medical University ( Guangzhou, China ) and maintained in a temperature and humidness controlled room. All the animate beings had free entree to standard mouse Zhou and H2O. Male and female mice mated of course, and the twenty-four hours of birth was designated as twenty-four hours 1. Testiss were separately collected from the mice 1, 2, 3, 4, 6, 8 hebdomads and 6 months old. Other variety meats including encephalon, bosom, lung, liver, kidney, lien, epididymis, and vesica from grownup mice and all samples instantly frozen in RNA stabilisation reagent RNAlater ( QIAGEN, Valencia, CA, USA ) . Animal experiments were approved by The Ethics Committee of Peking University Shenzhen Hospital.
2.2.Antibodies. The rabbit polyclonal anti-CCDC38 antibody ( ab170231 ) and the mouse monoclonal anti-GAPDH antibody ( ab8245 ) were purchased from Abcam ( Abcam, Cambridge, UK ) . The mouse anti-ubiquityl-histone H2A antibody was purchased from Millipore ( Millipore, Billerica, MA, USA ) . Anti-rabbit-Alexa Fluor 488 and anti-mouse-Cy3 were purchased from Invitrogen ( Carlsbad, CA, USA ) .
2.3.Plasmids Construction and Cell Culture. The full length ofCcdc38complementary DNA was amplified by PCR with the primers 5’- ATGGCATCCCAGATGC -3’ ( frontward ) and 5’- ACTAAAAAAGTACTCTTCGTC -3’ ( contrary ) , and so inserted into pCDNA3.1/HA plasmids via BamH1 and Xhol. The full length ofH2Acomplementary DNA was amplified by PCR with the primers 5’- ATGTCTGGACGTGGCAAACAG -3’ ( frontward ) and 5’- TTATTTCCCCTTGGCCTTGTGG -3’ ( contrary ) , and so inserted into pEGFP-C1 plasmids via BamH1 and EcoR1. The PCR merchandises were cloned and sequenced. Two cell lines, TM4 and HEK293T were obtained from the American Type Culture Collection ( ATCC ) . The cells were maintained in Dulbecco Modified Eagle Medium ( Life Technologies, Rockville, MD ) supplemented with 10 % foetal bovine serum at 37 EsC in a humidified ambiance with 5 % CO2.
2.4. RT-PCR and Quantitative Real-time PCR. Entire RNAs were extracted from mouse tissues utilizing the TRIzol ( Invitrogen, Carlsbad, CA, USA ) harmonizing to the manufacturer’s instructions. Entire RNAs ( 1ug ) were used as templets for the contrary written text utilizing the oligomer ( dT ) 20 as a primer and PrimeScript RT Enzyme Mix I ( Takara, Shiga, Japan ) . Reverse and frontward oligonucleotide primers, specific to the chosen campaigner cistrons, were designed utilizing Primer Express 2.0 Software ( Applied Biosystems, Foster City, CA, USA ) as described by the maker. The primer sequences were as follows: mouseCcdc38frontward primer: 5’- CTTGTCCTGTTAGTCCTGTATAG -3’ , rearward primer: 5’- CGTAGAGATGAAGTGTGATGAT -3’ ; mouseGapdh( as an internal control ) frontward primer: 5’- AGTGGCAAAGTGGAGATT -3’ , rearward primer: 5’- GTGGAGTCATACTGGAACA -3’ . The undermentioned PCR conditions were used: 98 °C for 2 min ; 32 rhythms of 98 °C for 10 s, 55 °C for 30 s and 72 °C for 30 s ; followed by 72 °C for 5 min. All samples from assorted day of the month testicles and other variety meats were plated in triplicate PCRs. We performed the quantitative real-time PCR experiments utilizing Quantitative RT-PCR system with the primers ( as above primers ) . Data were calculated harmonizing to the Applied Biosystems Comparative Ct Method ( ??CT Method ) .
2.5. Western Blot. The protein infusions of mouse assorted tissues ( 20 ug ) were subjected to 12 % SDS polyacrylamide gel and transferred to PVDF membrane. After being blocked in 5 % fat-free milk, the membrane was incubated with anti-CCDC38 antibody ( 1:500 ) overnight at 4 °C, the membrane was treated with HRP-labeled secondary antibody for 1 H at room temperature. Positive sets were detected utilizing the ECL kit. ( Thermo Scientific, Waltham, MA, USA ) .
2.6. Immunohistochemistry and Immunofluorescence. Paraffin subdivisions were prepared as described antecedently [ 15 ] . After being blocked in 10 % caprine animal serum, the subdivisions were incubated with coney anti-CCDC38 antibody ( 1:300 ) , rabbit anti-uH2A ( 1:100 ) antibody overnight at 4 °C. The subdivisions were washed with PBS and incubated for 1 H at 37°C with the secondary antibodies. The slides were so treated with 0.5 ?g/ml DAPI for 5 proceedingss at roomtemperature, washed in PBS, mounted, and observed under a x100 LSM 710 oil lens ( Zeiss Instruments Inc. ) . DAB staining was carried out harmonizing to the manufacturer’s recommended protocol ( ABC kit ; MAB ) . The DAB slides were observed under x40 LEICA DM4000B lens. In all the immunostaining protocols, the degree of nonspecific staining was determined by skip of the incubation measure with the primary antibody.
2.7. Co-immunoprecipitation ( Co-IP ) assay. Whole testicle infusions were prepared with lysis buffer ( 10 millimeter Tris pH 7.4, 1.0 % Triton X-100, 0.5 % NP-40, 150 millimeter NaCl, 20 millimeter NaF, 1 millimeter EDTA, 1 millimeter EGTA, and 0.2 millimeters PMSF ) supplemented with peptidase inhibitors. After centrifugation, the supernatant was incubated with anti-CCDC38 and anti-uH2A antibodies overnight at 4 °C. Protein A/G beads ( 60 ?l ) were so added to each sample, and the mixtures were incubated at 4 °C for 1 h. The beads were washed three times with lysis buffer, boiled in sample buffer incorporating 0.2 M dithiothreitol, and analyzed by Western smudge as described above.
2.8. Statistical Analysis. Each of the experiments was repeated at least three times, and informations were plotted as the mean ± criterion divergence. Student’sT-test was used to compare the difference between two groups. Probability (Phosphorus) values equal to or less than 0.05 were considered to be statistically important.
3. Consequences
3.1.Designation of Ccdc38by in Silico Screen. From UniGene libraries databases we identified a testis-specific cistronCcdc38.To farther qualify look of this cistron, we foremost analyzed its construction and map by utilizing systematic bioinformatics methods. TheCcdc38encodes a predicted protein of aminic acids with a molecular weight of about 65KD. Further homology hunt of other craniates in GenBank showed several predicted homologues merely in other mammals ( Figure. 1A ) . An amino acid alliance revealed that the mouse CCDC38 shared a high sequence homology with the mammalian homologues. The CCDC38 protein showed three coiled-coil spheres by seeking the Pfam database. Sequence analysis indicated that CCDC38 was a serine-rich protein. Post-translation alteration analysis showed that CCDC38 had two possible sites: twelve Ser phosphorylation sites and one Thr phosphorylation site ( Figure. 1B ) .
3.2. Expression of CCDC38 in Mice. To look into look form ofCcdc38in grownup mouse tissues, the mRNA degree of Ccdc38 was examined by semi-quantitative PCR and quantitative real-time PCR in grownup mouse tissues.Ccdc38was entirely expressed in testicle ( Figure. 2A ) . To find its protein degree, a polyclonal anti-CCDC38 antibody against the coding part of CCDC38. Western smudge analysis showed an alone set at 65KD in mouse testicle, comparable to the predicted molecular weight by Calculating pI/Mw [ 16 ] . The protein degree of CCDC38 was consistent with its messenger RNA ( Figure. 2B ) . These consequences indicate that the look of CCDC38 is testis-specific in mouse. We further examined the timing of mouse CCDC38 look during postpartum testicle development in both messenger RNAs and protein degrees. As shown in Figure. 2C, look ofCcdc38was detected after 2 hebdomads and bit by bit increased from 2 hebdomads to 6 months. Western smudge analysis showed that the CCDC38 protein foremost appeared at 2 hebdomads and bit by bit increased from 2 hebdomads to 6 months, which was coincident with its look of messenger RNA ( Figure. 2D ) . These consequences suggest that CCDC38 is developmentally regulated during spermatogenesis.
3.3. CCDC38 Protein is Predominantly Expressed in Spermatogonia andSpermatocytes. In order to look into the cell types of the CCDC38 protein in testicle, we performed immunocytochemical staining on subdivisions of the juvenile and grownup mouse testes utilizing the coney polyclonal antibody. CCDC38 was preponderantly expressed in the karyon of the spermatogonia and spermatocytes from 2 hebdomads to grownups ( Figure. 3 ) .
3.4. CCDC38 Protein interacts with uH2A. CCDC38 and uH2A was examined by immunofluorescence in the testicles from grownup mice. The consequences indicated that CCDC38 and H2A ubiquitination protein partly co-localized in the karyon of spermatogonia and spermatocytes ( Figure. 4A ) . Further, invivoandvitroCo-IP experiments were performed to find whether CCDC38 can interact with uH2A. We found that CCDC38 protein could be pulled down by anti-uH2A antibody, which strong demonstrated CCDC38 interacted with uH2A in mouse testicle ( Figure. 4B and C ) .
4.Discussion
Spermatogenesis is characterized by consecutive periods of regulated cell proliferation, miosis, and monoploid distinction. Abnormalies during any measure of spermatogenesis could do male sterility. It is estimated that about 2,000 cistrons regulate the procedure of spermatogenesis, and merely a little proportion of them has been identified in sterile work forces so far [ 17 ] . Molecular mechanisms and elaborate maps of most of these cistrons remain mostly unknown. Therefore, placing cardinal cistrons that regulate this procedure will doubtless put a solid base for our farther apprehension and better use of spermatogenesis.
In the procedure of spermatogenesis, protein phosphorylation participates in many cellular procedures including miosis, cell rhythm ordinance, cistron written text ordinance, cell energy metamorphosis, and DNA harm reparation. CCDC38 is a Ser-rich protein with many possible phosphorylation sites, which indicates that this protein may exercise its functions through kinase signaling during spermatogenesis. Designation of the cistronCcdc38in the list of spermatogenesis cistrons is a new advancement in male reproduction. The undermentioned groundss supported association ofCcdc38with spermatogenesis. First, multiple tissue analysis ofCcdc38indicated that it was entirely expressed in testicle. The testis-specific look of CCDC38 implied its possible functions in spermatogenesis. Further immunohistochemistry analysis indicated that CCDC38 protein was chiefly localized in karyon of spermatogonia and spermatocytes of the seminiferous tubules. Second, RT-PCR and Western smudge analysis indicated that both the messenger RNA and protein degrees of CCDC38 were increased from postpartum 2 hebdomads to 8 hebdomads in mouse testicle. In the old studies source cells are known to come in the meiotic prophase around postpartum twenty-four hours 10 and so continue through a consecutive procedures of the first moving ridge of miosis during the undermentioned 10 yearss in mouse [ 18, 19 ] . So it is notable that the developmentally regulated look form of CCDC38 may be related to spermatogenic events.
Spermatogenesis involves one of the most dramatic chromatin remodeling procedures, including synapsis and transcriptional silencing. Meiotic chromatin hushing involves differential histone alterations, including ubiquitination, phosphorylation, methylation and acetylation. H2A is the first protein to be identified as being ubiquitinated [ 20 ] . Ubiquitinated H2A ( uH2A ) represents the most abundant ubiquitination substrate in mammals, consisting 5-15 % of entire H2A. Previous work has shown that a high sum of uH2A was detected in pachytene spermatocytes by immunoblot and immunohistochemical analysis of wild-type mouse testicle [ 21 ] . Our experiments showed that CCDC38 protein localized in karyon of spermatogonia and spermatocytes. Using support vector machine combined with car covariance to foretell protein-protein interactions from protein sequences [ 22 ] and uniting with the old experimental consequences, we speculated that CCDC38 possibly interact with uH2A in mouse testicle. In order to attest this suppose, we perform immunocolocalization and Co-IP checks in the following experiment. We found that CCDC38 and uH2A partly co-localized in the karyon of spermatogonia and spermatocytes. As expected, CCDC38 can interact with uH2A invivoandvitro. In add-on, H2A ubiquitination that occurs at lysine 119 leads to cistron hushing or repression, which plays assorted functions in cellular procedures such as transcriptional ordinance and DNA harm fix [ 23-25 ] . In our survey, we found CCDC38 associated with the meiotic procedure and interacted with uH2A in mouse testicle. So, we supposed that CCDC38 may play a function in transcriptional silencing during spermatogenesis.
5.Decision
This survey has identified a testis-specific cistronCcdc38which was conserved in mammalian species. The look and localisation of CCDC38 protein indicated that it may play a function in spermatogenesis. In add-on, CCDC38 may modulate spermatogenesis by interacting with uH2A. Further probe is required to find the molecular mechanisms of CCDC38 in spermatogenesis.
1
