be cut by the same restriction enzyme
In order to insert a human gene into a plasmid, both must _____
DNA ligase
What enzyme forms covalent bonds between restriction fragments?
lack of growth hormone
What defect causes pituitary dwarfism?
a method to produce many copies of a gene
What is genetic cloning?
false. The use of growth hormone isolated from cadavers was banned mainly because the isolated hormone was potentially contaminated with prion proteins.
True or false? The use of growth hormone isolated from cadavers was banned mainly because there were not enough cadavers to supply the hormone.
It makes complementary DNA (cDNA) from mRNA.
Which of the following statements best describes the function of reverse transcriptase?
Match the region of radioactivity on the filter with the corresponding plate.
Which of the following steps would be performed last when screening a cDNA library?
Put a cDNA encoding the protein into a plasmid with a bacterial promoter sequence.
How can large quantities of protein be produced from a bacterial colony containing the gene of interest?
true
True or false? The term “sticky ends” refers to the overhanging ends on DNA that are generated by restriction enzymes, which can base pair with any DNA molecules that contain complementary sticky ends.
sticky ends
The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____.
They make a staggered cut within the recognition site by cutting the two DNA strands at different locations
Which answer best explains why restriction endonucleases like EcoRI create DNA fragments with sticky ends?
TTTTAGCCATTTA CGATT AATCG
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5′ to 3′)?
No, because each cDNA is likely to be present in more than one copy after mRNA isolation and cDNA synthesis
For the pituitary gland cDNA library shown in Figure 20.4, is each type of cDNA in the library likely to be represented just once? Why or why not?
reverse transcriptase
If mRNAs could be ligated and replicated within plasmids, what enzyme commonly used in recombinant DNA technology would no longer be needed?
Both BamHI-cut and BclI-cut DNAs would be ligated with no preference for which fragment is ligated to which other.
If one sample of DNA was cut with BamHI and another with BclI, and these two samples were mixed and treated with DNA ligase, what would occur?
a plasmid used to transfer DNA into a living cell
In recombinant DNA methods, the term vector can refer to _____.
It could be used to create a complete genomic library.
Which of the following would NOT be true of cDNA produced using human brain tissue as the starting material?
post-transcriptional processing
Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problem of _____.
probe the library using a labeled single-stranded DNA complementary to the gene
To isolate a cloned gene from a DNA library, researchers ______.
Whether the gene is methylated
What information can not be obtained from the sequence of a gene?
A method to amplify a fragment of DNA.
What is the polymerase chain reaction (PCR)?
true
True or false? Comparison of the sequences of the same gene across species can give some insight into the existence of a common ancestor with that gene.
false. Taq polymerase is derived from a species of bacteria living in hot springs, which makes it stable at the high temperature required for the denaturation step of PCR.
True or false? The Taq enzyme is a type of DNA polymerase that allows researchers to separate the DNA strands during the annealing step of the PCR cycle without destroying the polymerase.
32
How many DNA molecules would there be after four rounds of PCR if the initial reaction mixture contained two molecules?
extension
During which step in the PCR cycle are nucleotides used?
annealing
During which step in the PCR cycle do primers form bonds with a single-stranded template?
polymerase chain reaction (PCR)
A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). To compare a specific region of the DNA from the sample with DNA from living birds, which of the following would be most useful for increasing the amount of dodo DNA available for testing?
a few modern H. sapiens with some Neanderthal sequences
A recent study compared the Homo sapiens genome with that of Neanderthals. The results of the study indicated that there was a mixing of the two genomes at some period in evolutionary history. Additional data consistent with this hypothesis could be the discovery of _____.
The DNA sequence of the ends of the DNA to be amplified must be known.
What information is critical to the success of polymerase chain reaction (PCR) itself?
PCR requires much less DNA for analysis.
In early forensic applications of DNA fingerprinting, DNA was extracted from crime scene material, digested with restriction enzymes, and then used to prepare a Southern blot. Today, polymerase chain reaction (PCR) is used in the early steps of forensic DNA analysis. Which of the following is an advantage that PCR provides over the former method?
negative … positive
In gel electrophoresis DNA molecules migrate from _____ to _____ ends of the gel.
SNPs where one allele is found more often in persons with a particular disorder than in healthy controls
In large scale, genome-wide association studies in humans we look for _____.
find which of the students has which alleles
Six students have taken samples of their own cheek cells, purified the DNA, and used an enzyme (endonuclease) known to cut at zero, one, or two sites in a particular gene of interest.
They might be conducting such an experiment to _____.
can be valuable animal models of human disease
Transgenic mice are useful to human researchers because they _____.
retrovirus
A virus consisting of a single strand of RNA, which is transcribed into complementary DNA, is a _____.
Transferred genes may not have appropriately controlled activity.
Which of the following is one of the technical reasons why gene therapy is problematic?
a dominant disorder
Which type of disorder is most difficult to correct by gene therapy?
DNA copies of retroviral genomes become integrated into the genome of the infected cell.
For applications in gene therapy, what is the most favorable characteristic of retroviruses?
integrate recombinant DNA into the genome in ways that misregulate the expression of genes at or near the site of integration
Using retroviral vectors for gene therapy might increase the patient’s risk of developing cancer because they might _____.
isolating the patient’s bone marrow cells, infecting them with genetically engineered viruses, and injecting them back into the patient’s bone marrow
In the form of gene therapy used successfully for severe combined immunodeficiency syndrome (SCID)-X1, the genetic engineering of human cells is done by _____.
It is rich in beta-carotene.
Why is golden rice pale yellow in color?
blindness
Which of these is a symptom of vitamin A deficiency?
beta-carotene
Which of these is a vitamin A precursor?
seems unlikely
The transfer of antibiotic-resistant genes from genetically engineered bacteria to disease-causing bacteria _____.
a somatic plant cell can often give rise to a complete plant
Plants are more readily manipulated by genetic engineering than are animals because _____.
Bacterial plasmids and the genes they carry usually are not integrated into the chromosome; Ti plasmids and the genes they carry are integrated into the chromosome.
Plasmids are used as vectors in plant and bacterial genetic engineering. However, there is a major difference in the fate of genes introduced into bacteria on most bacterial plasmids and into plants on tumor-inducing (Ti) plasmids. What is this difference?
Genetically engineer several genotypes within single crop types.
One predicted aspect of climate change is that climates, including precipitation and temperature, over most of the Earth will become more variable. Which of the following is a good crop genetic engineering strategy if this is true?
improved product quality and increased pest and herbicide resistance
The areas that have received the greatest attention in genetically modified plants are _____.
discovery of a plasmid that could be modified to introduce genes into plants
One example of an innovation from an unexpected source comes from studies of tumor-like plant growths. What information did the study of plant tumors provide that was critical for plant genetic engineering?
